View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_155 (Length: 251)
Name: NF1172_low_155
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_155 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 108; Significance: 2e-54; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 29 - 144
Target Start/End: Original strand, 50311944 - 50312059
Alignment:
| Q |
29 |
accaactacatgcatgaattttgaatctattctttccaatgcttaatgtattaaatatgaatcgtagagtagtgtatgtcatgtaataatgaatattata |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50311944 |
accaactacatgcatgaattttgaatctattctttctaatgtttaatgtattaaatatgaatcgtagagtagtgtatgtcatgtaataatgaatattata |
50312043 |
T |
 |
| Q |
129 |
tatgttagctagaaac |
144 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
50312044 |
tatgttagctagaaac |
50312059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 29 - 82
Target Start/End: Complemental strand, 40763634 - 40763581
Alignment:
| Q |
29 |
accaactacatgcatgaattttgaatctattctttccaatgcttaatgtattaa |
82 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| | ||| ||| ||||||||| |
|
|
| T |
40763634 |
accaactacatacatgaattttgaatgtattcttcctaattcttcatgtattaa |
40763581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University