View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_156 (Length: 251)
Name: NF1172_low_156
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_156 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 18 - 136
Target Start/End: Complemental strand, 24134 - 24015
Alignment:
| Q |
18 |
aagcaaagttccaaagacttag-tagaagcatatgctcccttgttcctggttgcagcttcagtacctggtttcaaaatgaataattgtatcaatnnnnnn |
116 |
Q |
| |
|
|||||| ||||| ||||||||| |||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
24134 |
aagcaacgttccgaagacttaggtagaagcagctgctcccttgttcctgggtgcagcttcagtacctggtttcaaaatgaatcaatgtatcaacaaacaa |
24035 |
T |
 |
| Q |
117 |
ncaatccagaaaaaataaca |
136 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
24034 |
gcaatccagaaaaaataaca |
24015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University