View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_160 (Length: 249)
Name: NF1172_low_160
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_160 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 59; Significance: 4e-25; HSPs: 4)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 3 - 65
Target Start/End: Original strand, 29999738 - 29999800
Alignment:
| Q |
3 |
gattatgttccttggctaggcatttttgaccttcaggtacatttgtactctttattactacta |
65 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
29999738 |
gattatgttccttggctaggcatttttgaccttcaggtacatttgtactatttattactacta |
29999800 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 3 - 41
Target Start/End: Original strand, 29991034 - 29991072
Alignment:
| Q |
3 |
gattatgttccttggctaggcatttttgaccttcaggta |
41 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
29991034 |
gattatgttccttggctaggaatttttgaccttcaggta |
29991072 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 3 - 42
Target Start/End: Original strand, 30006176 - 30006215
Alignment:
| Q |
3 |
gattatgttccttggctaggcatttttgaccttcaggtac |
42 |
Q |
| |
|
|||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
30006176 |
gattatgtaccttggctaggcgtttttgaccttcaggtac |
30006215 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 3 - 41
Target Start/End: Complemental strand, 30044978 - 30044940
Alignment:
| Q |
3 |
gattatgttccttggctaggcatttttgaccttcaggta |
41 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||| |
|
|
| T |
30044978 |
gattatgttccttggctaggaatttttgatcttcaggta |
30044940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 192 - 233
Target Start/End: Original strand, 9829375 - 9829416
Alignment:
| Q |
192 |
caccactaaaataaatattgtttccttcctcactgtatgtcg |
233 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
9829375 |
caccaataaaatcaatattgtttccttcctcactgtatgtcg |
9829416 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University