View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_169 (Length: 220)
Name: NF1172_low_169
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_169 |
 |  |
|
| [»] scaffold0450 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr7 (Bit Score: 110; Significance: 1e-55; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 110; E-Value: 1e-55
Query Start/End: Original strand, 52 - 185
Target Start/End: Original strand, 8762350 - 8762483
Alignment:
| Q |
52 |
ccttgttcacctctatatgatgaaaagctagaggaagcaccatcattgaatgagttttttgcttgaaaaaatggaaggtttgaagggcttattccaaacc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
8762350 |
ccttgttcacctctatatgatgaaaagctagtggaagcaccatcattgaatgagttttttgcttgaaaaaatggaaggtttgaagagcttattccaaacc |
8762449 |
T |
 |
| Q |
152 |
tgttttgaccatgcccattattctccgcaacagc |
185 |
Q |
| |
|
|||||||| |||| ||| |||||||| ||||||| |
|
|
| T |
8762450 |
tgttttgatcatggccactattctccacaacagc |
8762483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 108; E-Value: 2e-54
Query Start/End: Original strand, 52 - 183
Target Start/End: Original strand, 8788881 - 8789012
Alignment:
| Q |
52 |
ccttgttcacctctatatgatgaaaagctagaggaagcaccatcattgaatgagttttttgcttgaaaaaatggaaggtttgaagggcttattccaaacc |
151 |
Q |
| |
|
||||||||||||||||||||||||||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||||| | |||||||||||| |
|
|
| T |
8788881 |
ccttgttcacctctatatgatgaaaagctagtggaagcaccatcatggaatgaggtttttgcttgaaaaaatggaaggtttgaagagtttattccaaacc |
8788980 |
T |
 |
| Q |
152 |
tgttttgaccatgcccattattctccgcaaca |
183 |
Q |
| |
|
||||||||||||| |||||||||||||||||| |
|
|
| T |
8788981 |
tgttttgaccatggccattattctccgcaaca |
8789012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0450 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0450
Description:
Target: scaffold0450; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 85 - 135
Target Start/End: Complemental strand, 9554 - 9504
Alignment:
| Q |
85 |
gaagcaccatcattgaatgagttttttgcttgaaaaaatggaaggtttgaa |
135 |
Q |
| |
|
||||||||||||||||| |||||||| || ||||||| || |||||||||| |
|
|
| T |
9554 |
gaagcaccatcattgaaggagtttttcgcctgaaaaactgaaaggtttgaa |
9504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University