View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1172_low_174 (Length: 215)

Name: NF1172_low_174
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1172_low_174
NF1172_low_174
[»] chr8 (1 HSPs)
chr8 (11-107)||(39033839-39033935)


Alignment Details
Target: chr8 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 11 - 107
Target Start/End: Complemental strand, 39033935 - 39033839
Alignment:
11 atctttcgacaaagttgtgagttcacttggttagatgatgtgctcgtcattaaaacttgacataatttgggttgcggctgttttgaacaatcctttg 107  Q
    |||||| ||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||    
39033935 atcttttgacaaagttgtgagttcacttggttagatgatgtgctcgccattaaaacttgacataatttgggttgcggctgttttgaacaatcatttg 39033839  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University