View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_177 (Length: 202)
Name: NF1172_low_177
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_177 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 1 - 173
Target Start/End: Original strand, 43953746 - 43953918
Alignment:
| Q |
1 |
gacataagatgtgagattccttgtgcttcgagagctgcctcgtagacttcannnnnnnctagtatcaccatctacatttctcccgggaaaatgcaaaaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953746 |
gacataagatgtgagattccttgtgcttcgagagctgcctcgtagacttcatttttttctagtatcaccatctacatttctcccgggaaaatgcaaaaca |
43953845 |
T |
|
| Q |
101 |
aaatgatttctttcggtatcttgtatttcagctggaaggcgaataaatctatcctgaacaggagtgtcattct |
173 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43953846 |
aaatgatttctttcggtatcttgtatttcagctggaaggcgaataaatctatcctgaacaggagtgtcattct |
43953918 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University