View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_180 (Length: 201)
Name: NF1172_low_180
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_180 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 97; Significance: 7e-48; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 97; E-Value: 7e-48
Query Start/End: Original strand, 1 - 117
Target Start/End: Complemental strand, 24863472 - 24863356
Alignment:
| Q |
1 |
ttttccattaaaattaagatagttagtgtctcggtagcgtagctcaattggcagagacaataaattgttatatataaaagtcgaggttcgaatatcaaac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||| || |
|
|
| T |
24863472 |
ttttccattaaaattaagatagttagtgtctcggaagcgtagctcaattgacagagacaagaaattgttatatataaaagtcgaggttcgaatatcagac |
24863373 |
T |
|
| Q |
101 |
atcccatttattcatct |
117 |
Q |
| |
|
|||| |||||||||||| |
|
|
| T |
24863372 |
atcctatttattcatct |
24863356 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University