View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_48 (Length: 439)
Name: NF1172_low_48
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_48 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 37; Significance: 0.00000000001; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 37; E-Value: 0.00000000001
Query Start/End: Original strand, 36 - 91
Target Start/End: Complemental strand, 45333519 - 45333461
Alignment:
| Q |
36 |
aattgaacaatggttgatgtcattttacttgagtgatg---aggtgttctttacaacac |
91 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| ||||||||| |||||||| |
|
|
| T |
45333519 |
aattgaactatggttgatgtcattttacttgagtgatgatcaggtgttctgtacaacac |
45333461 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000004; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000004
Query Start/End: Original strand, 115 - 189
Target Start/End: Original strand, 43322747 - 43322821
Alignment:
| Q |
115 |
ttggtggtgttatatgatgcaattgcttttatctcaaattgttagaacactactacttttcatatgtcaattttg |
189 |
Q |
| |
|
|||||||||||| |||| |||||||||| |||||||||||| || |||||||||||||||| || |||||| |
|
|
| T |
43322747 |
ttggtggtgttaaatgagtcaattgctttaatctcaaattgtccaaatgctactacttttcatatttcgattttg |
43322821 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University