View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_62 (Length: 392)
Name: NF1172_low_62
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_62 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 151 - 380
Target Start/End: Original strand, 4189725 - 4189957
Alignment:
| Q |
151 |
ttgttgtcatttttgtattgtagtgtgttagtcgaacggacaa----acgagccgaatctaacgagttgaatagagttattcacctatctagacaagtta |
246 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189725 |
ttgttgtcatttttgtattgtagtgtgttagtcgaacgaacaattaaacgagccgaatctaatgagttgaatagagttattcacctatctagacaagtta |
4189824 |
T |
 |
| Q |
247 |
aactagaactaaaagaaatattcacatcaaattggttgagtttcaaaccgaatcaattcttattgagttggggtcaaattttacggagtttgactaaatc |
346 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||| | |
|
|
| T |
4189825 |
aactagaactaaaagaaatatacacatcaaattggttgagtttcaaatcgaatcaattcttattgagtt-gggtcaaattttacggagtttgactaaacc |
4189923 |
T |
 |
| Q |
347 |
gacttatttcatttccagtcatatttacaatatt |
380 |
Q |
| |
|
||||||||||||||| |||||||||||||||||| |
|
|
| T |
4189924 |
gacttatttcatttcgagtcatatttacaatatt |
4189957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 33 - 98
Target Start/End: Original strand, 4189610 - 4189675
Alignment:
| Q |
33 |
ttatatttgtgtcagttacacaccttatgcttaagatagattttatttttgttcaatctttgcatt |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4189610 |
ttatatttgtgtcagttacacaccttatgcttaagatagattttatttttgttcaatctttgcatt |
4189675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University