View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_69 (Length: 376)
Name: NF1172_low_69
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_69 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 126; Significance: 7e-65; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 126; E-Value: 7e-65
Query Start/End: Original strand, 97 - 234
Target Start/End: Original strand, 32772267 - 32772404
Alignment:
| Q |
97 |
acttttgttgtggcttctgttatagtaaaaatagaaattgcattatttattttttacttaactgttggcctttgttcactattggctttgttggatgcta |
196 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32772267 |
acttttgttgtggcatctgttatagtaaaaatagaaattgcattatttattttttacttaactgttggcctttgttcactattggctttgttggatgcta |
32772366 |
T |
|
| Q |
197 |
caaagcaagtgttatttagatatgtatcctttgcttct |
234 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| |||| |
|
|
| T |
32772367 |
caaagcaagtgttatttagatatgtatcccttgattct |
32772404 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University