View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_77 (Length: 365)
Name: NF1172_low_77
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 188; Significance: 1e-102; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 188; E-Value: 1e-102
Query Start/End: Original strand, 34 - 257
Target Start/End: Complemental strand, 9934253 - 9934031
Alignment:
| Q |
34 |
tcaataggtccaaagggattaccacaaagatcattggataaaggtcatctctctaatacacatgaacatgcaacttgacaaccgaatttaagatctttct |
133 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||| || |||||||||||||||||||||| ||||||||||| |||||| |
|
|
| T |
9934253 |
tcaataggtccaaagggattaccataaagatcattggataaaggtaatctctcta-tagacatgaacatgcaacttgacaagcgaatttaagagctttct |
9934155 |
T |
|
| Q |
134 |
aaacgcgaattaaagtgcatacaacacacacactcttagaagattttaacaagttatcacttggcttaggtaagaggtggatgatttcgtaaagtagtat |
233 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9934154 |
aaacgcgaatcaaagtgcatacaacacacacactcttagaagattttaacaagttataacttggcttaggtaagaggtggatgatttcgtaaagtagtat |
9934055 |
T |
|
| Q |
234 |
tgaattggagttaggtttctacta |
257 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
9934054 |
tgaattggagttaggtttctacta |
9934031 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 74; E-Value: 7e-34
Query Start/End: Original strand, 274 - 351
Target Start/End: Complemental strand, 9933499 - 9933422
Alignment:
| Q |
274 |
cactcttttaccttttgtctttggtttgaattgattgtgtcgaaaagttatttgtttggaacattgagtttgattgcc |
351 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9933499 |
cactcttttaccttttgtctttggtttgaattgattgtgttgaaaagttatttgtttggaacattgagtttgattgcc |
9933422 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University