View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_80 (Length: 358)
Name: NF1172_low_80
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_80 |
 | |
|
| [»] chr6 (2 HSPs) |
| |
|
Alignment Details
Target: chr6 (Bit Score: 195; Significance: 1e-106; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 157 - 358
Target Start/End: Complemental strand, 6126813 - 6126611
Alignment:
| Q |
157 |
ggatgcaacggtagagagagaggcttgcaagtgagcggcggctgtttcatctcactaagcaatagcagttaataacattagggttacattaaaagtgata |
256 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6126813 |
ggatgcaacggtagagagagaggcttgcaagtgagcggcggctgtttcatctcactaagcaatagcagttaataacattagggttacattaaaagtgata |
6126714 |
T |
|
| Q |
257 |
ttgagccacatgtagaaacgtgggtttgggccaaacatatatat-ttaagttaatattgtacccaaacattatttccttttatttattgcaatactacct |
355 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6126713 |
ttgagccacatgtagaaacgtgggtttgggccaaacatatatatcttaagttaatattgtacccaaacattatttccttttatttattgcaatactacct |
6126614 |
T |
|
| Q |
356 |
att |
358 |
Q |
| |
|
||| |
|
|
| T |
6126613 |
att |
6126611 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 11 - 86
Target Start/End: Complemental strand, 6126959 - 6126884
Alignment:
| Q |
11 |
cacagattgagaaatattcaaccaagattgctagaagaagaagaaataattggactgtatgattcgattcaagaag |
86 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6126959 |
cacagattgagaaatattcaaccaagattgctagaagaagaagaaataattggactgtatgattcgattcaagaag |
6126884 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University