View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1172_low_91 (Length: 329)
Name: NF1172_low_91
Description: NF1172
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1172_low_91 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 102; Significance: 1e-50; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 14 - 119
Target Start/End: Complemental strand, 45795203 - 45795098
Alignment:
| Q |
14 |
cagagactaaagaagataatcatctttatcaataataagaattagttttacagggactaaaataaaaacattaatatctaccgagtactaaaaacaacac |
113 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45795203 |
cagagactaaagaagataatcatctttattaataataagaattagttttacagggactaaaataaaaacattaatatctaccgagtactaaaaacaacac |
45795104 |
T |
 |
| Q |
114 |
atataa |
119 |
Q |
| |
|
|||||| |
|
|
| T |
45795103 |
atataa |
45795098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 153 - 233
Target Start/End: Complemental strand, 45795106 - 45795026
Alignment:
| Q |
153 |
cacacataacaacatttgattttgactcttgtgaaatgcagtggtaaagggcaaaagattcatctgcaaagatatgggttt |
233 |
Q |
| |
|
|||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45795106 |
cacatataacaacatttgattttcactcttgtgaaatgcagtggtaaagggcaaaagattcatctgcaaagatatgggttt |
45795026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University