View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11730_high_5 (Length: 282)
Name: NF11730_high_5
Description: NF11730
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11730_high_5 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 260; Significance: 1e-145; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 260; E-Value: 1e-145
Query Start/End: Original strand, 19 - 282
Target Start/End: Complemental strand, 48318180 - 48317917
Alignment:
| Q |
19 |
gaaaatacatgtgcttcgaatattgccaatttcttttggtcttttattggttagaaaacagaattgacttggcttccataatttgattaagttcaaaaat |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48318180 |
gaaaatacatgtgcttcgaatattgccaatttcttttggtcttttattggttagaaaacagaattgacttggcttccataatttgattaagttcaaaaat |
48318081 |
T |
 |
| Q |
119 |
atagttttgacatgaagtggtttttggttgtttgtgtagggaatgctcttcatgtttttaggaacagtctttctgaccccaacaatgtgcttcagagctg |
218 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48318080 |
atagttttgagatgaagtggtttttggttgtttgtgtagggaatgctcttcatgtttttaggaacagtctttctgaccccaacaatgtgcttcagagctg |
48317981 |
T |
 |
| Q |
219 |
ggacccaacattggttaatccatgtacttggtttcatgttacatgtgactccaacaaccgtgtg |
282 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48317980 |
ggacccaacattggttaatccatgtacttggtttcatgttacatgtgactccaacaaccgtgtg |
48317917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 275
Target Start/End: Original strand, 250539 - 250648
Alignment:
| Q |
166 |
cttcatgtttttaggaacagtctttctgaccccaacaatgtgcttcagagctgggacccaacattggttaatccatgtacttggtttcatgttacatgtg |
265 |
Q |
| |
|
||||||| ||| || | ||| |||||||| |||||||| || ||||| ||||||||||| || | ||||| ||||||||||||| |||||||| || | |
|
|
| T |
250539 |
cttcatgctttcagaaccagactttctgatcccaacaacgtccttcaaagctgggaccctactcttgttaactcatgtacttggttccatgttacctgcg |
250638 |
T |
 |
| Q |
266 |
actccaacaa |
275 |
Q |
| |
|
|||||||||| |
|
|
| T |
250639 |
actccaacaa |
250648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University