View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11731_high_12 (Length: 247)
Name: NF11731_high_12
Description: NF11731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11731_high_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 1 - 233
Target Start/End: Complemental strand, 28022852 - 28022620
Alignment:
| Q |
1 |
gaaacttcactaaaacatgtagtttcaggtctgatggcagtggatcaacaatgagagtaactgtttctgtttcatctccgcacaaagcatagaatccaat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
28022852 |
gaaacttcactaaaacatgtagtttcaggtctgatggcagcggatcaacaatgagagtaactgtttctgtttcatctccgcgcaaagcatagaatccaat |
28022753 |
T |
 |
| Q |
101 |
ccttttctcattatccaactctatacccttgtaccagagattttgcctgtgtactcccacctccaactcgtcttcgattttgcttttaagatcaaaaaca |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28022752 |
ccttttctcattatccaactctatacccttgtaccagagattttgcctgtgtactcccacctccaactcgttttcgattttgcttttaagatcaaaaaca |
28022653 |
T |
 |
| Q |
201 |
agttctgataccgatatttctaccacaggttct |
233 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
28022652 |
agttctgataccgatatttctaccacaggttct |
28022620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University