View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11731_low_11 (Length: 275)
Name: NF11731_low_11
Description: NF11731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11731_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 146; Significance: 6e-77; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 146; E-Value: 6e-77
Query Start/End: Original strand, 69 - 257
Target Start/End: Complemental strand, 36443972 - 36443783
Alignment:
| Q |
69 |
ggacattaaatctatcttttttacgataaagaatcatgcagtcaacacaagttggtccaattcataaggattcagctcaaatcttataaagacttgagtt |
168 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
36443972 |
ggacattaaatctatcttttttacagtaaagaatcatgcagtcaacgcaagttggtccaattcataaggattcagctcaaatcctataaagacttgagtt |
36443873 |
T |
 |
| Q |
169 |
cgaatccaattgttaatgtacgaacctcgtttgcggtaatactt-agtatcaactctttcaacatttttagagtgttgatacgcttcttg |
257 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| ||||||||| |||||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
36443872 |
cgaatccaattgttaatgtagaaacctcgtttgcagtaatacttaagtatcaactatttcaacatttttagagtgttgatactcttcttg |
36443783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University