View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11732_high_33 (Length: 237)
Name: NF11732_high_33
Description: NF11732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11732_high_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 203; Significance: 1e-111; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 21649431 - 21649210
Alignment:
| Q |
1 |
gcacacaagaaaactgcaaattacacgtgaaggagaaaccctaacagagctaccgccttctctcaatcgcagtctagaacttatatactttaatcatgat |
100 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21649431 |
gcacacaagaaaactgcaaattacacccgaaggagaaaccctaacagagctaccgccttctctcaa-cgcagtctagaacttatatactttaatcatgat |
21649333 |
T |
|
| Q |
101 |
tttttgattaaatttaatctatagacgcatatcttaatattttttatgtttcaattgaatgatgcagcttttgaaatcgaaattcctacgaagtttttgc |
200 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21649332 |
ttttttattaaatttaatctatagacgcatatcttaatattttttatgtttcaattgaatgatgcagcttttgaaatcgaaattcctacgaagtttttgc |
21649233 |
T |
|
| Q |
201 |
tatagcaacagcaacatacccac |
223 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
21649232 |
tatagcaacagcaacatacccac |
21649210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 69; E-Value: 4e-31
Query Start/End: Original strand, 99 - 223
Target Start/End: Complemental strand, 21619853 - 21619730
Alignment:
| Q |
99 |
attttttgattaaatttaatctatagacgcatatcttaatattttttatgtttcaattgaatgatgcagcttttgaaatcgaaattcctacgaagttttt |
198 |
Q |
| |
|
|||||||||| ||||| |||||||||||| |||||||||| ||||||||||||| |||||||||||||||||||||||| ||||| ||| | ||||| |
|
|
| T |
21619853 |
attttttgatcaaattaaatctatagacggatatcttaat-ttttttatgtttctattgaatgatgcagcttttgaaattaaaattgctataagattttt |
21619755 |
T |
|
| Q |
199 |
gctatagcaacagcaacatacccac |
223 |
Q |
| |
|
||||| ||||||||||||||||||| |
|
|
| T |
21619754 |
gctatggcaacagcaacatacccac |
21619730 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University