View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11732_high_36 (Length: 222)
Name: NF11732_high_36
Description: NF11732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11732_high_36 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 1 - 212
Target Start/End: Original strand, 35470896 - 35471106
Alignment:
| Q |
1 |
ttattttttctttcttatgtctcttatactgtctctaaccattccctacgttttaaaataaatttcattttaacacataaaaatgttctaaaataaacat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35470896 |
ttattttttctttcttatgtctcttatactgtctctaaccattctctatgttttaaaataaatttcattttaacacataaaaatgttctaaaataaacat |
35470995 |
T |
 |
| Q |
101 |
tgttttgctttttcaatgtgatatcannnnnnnncttcaattctactcttcacatgatattgtctatgataatttcaaattattatattttactatacat |
200 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
35470996 |
tgttttgccttttcaatgtgatatcattttttttcttcaattctactcttcacatgatattgtctatgataatttcaaa-tattatattttactatacat |
35471094 |
T |
 |
| Q |
201 |
tttgactctgtg |
212 |
Q |
| |
|
||||||| |||| |
|
|
| T |
35471095 |
tttgactttgtg |
35471106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University