View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11732_low_18 (Length: 356)
Name: NF11732_low_18
Description: NF11732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11732_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 157; Significance: 2e-83; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 94 - 287
Target Start/End: Original strand, 12849236 - 12849429
Alignment:
| Q |
94 |
aataacattgttgtgtttttcttgggatctgatcagacaagaaacagacnnnnnnngttgaaagggttcaattcccaaacaccttttcctttgactatat |
193 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12849236 |
aataacattgttgtgtttttcttgggatctgatcagacaagaaacagacaaaaaaagttgacagggttcaattcccaaacaccttttcctttgactatat |
12849335 |
T |
 |
| Q |
194 |
taattatatcttggttggttattgtttgaactttttcatattactttgaaaatctttgtctgatttaagaagttctctttatatctttgaacta |
287 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12849336 |
taattatatcttggttggttattgtttgaactttttcttggtactttgaaaatctttgtctgatttaagaagttctctttatatctttgaacta |
12849429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 57; E-Value: 1e-23
Query Start/End: Original strand, 283 - 351
Target Start/End: Original strand, 12849461 - 12849529
Alignment:
| Q |
283 |
aactaatatttggaggaagatctgagacttgactcttgatactttttggaggaagctattgcttgatct |
351 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
12849461 |
aactaatttttggaggaagatctgaaacttgactcttgacactttttggaggaagctattgcttgatct |
12849529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University