View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11732_low_29 (Length: 277)
Name: NF11732_low_29
Description: NF11732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11732_low_29 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 16 - 132
Target Start/End: Complemental strand, 260201 - 260085
Alignment:
| Q |
16 |
gtaacaattcggcaagctgaacaactttttacgtatatgtatcacacccaaaatgaataaatggaagtagaatttccttttttcattttatggaacggtt |
115 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
260201 |
gtaacaattcggcaagctgaacaactttttacgtatatgtatcacgcccaaaatgaataaatggaagtagaatgtccttttttcattttatggagtggtt |
260102 |
T |
|
| Q |
116 |
accttattattatttgc |
132 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
260101 |
accttattattatttgc |
260085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 112 - 243
Target Start/End: Original strand, 259499 - 259630
Alignment:
| Q |
112 |
ggttaccttattattatttgctccttcaatctttcatcatagtccttctcatttgactcaagcacattctctctttcttcaaattgcccctcttttgatt |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |||||||| |||||| ||||| |||| ||| ||| |
|
|
| T |
259499 |
ggttactttattattatttgctccttcaatctttcatcaaagtccttctcatttgactcaagcaccttctctctatcttcatattgctcctcctttaatt |
259598 |
T |
|
| Q |
212 |
tgagttccttccgttggatttcaagtcttgat |
243 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||| |
|
|
| T |
259599 |
tgagttccttccattggatttcaaatcttgat |
259630 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 173 - 266
Target Start/End: Complemental strand, 260086 - 259989
Alignment:
| Q |
173 |
gcacattctctctttcttcaaattgcccctcttttgatttgagttccttccg----ttggatttcaagtcttgatttatgcttcatcacttgctctct |
266 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
260086 |
gcacattctctctttcttcaaattgcccctcttttgatttgagttccttccgttggttggatttcaagtcttgatttatgcttcatcacttgctctct |
259989 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University