View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11732_low_36 (Length: 228)
Name: NF11732_low_36
Description: NF11732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11732_low_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 174; Significance: 9e-94; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 174; E-Value: 9e-94
Query Start/End: Original strand, 1 - 211
Target Start/End: Complemental strand, 26192335 - 26192125
Alignment:
| Q |
1 |
caataataaaaccattcaaaaaagcactttttatgtctatttgatttaatttaatttaaaatttaaccaacatgcaaagacaaaaactaagtgtatagcc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
26192335 |
caataataaaaccattcaaaaaagcactttttatgtctatttgatttaatttaatttaaaatttaaccaacatgcaaagacaaaaattaagtgtatagcc |
26192236 |
T |
 |
| Q |
101 |
tcgagcaaggttccatgagtatacttctcctcatagtttattccacccttttggttataggnnnnnnnccattaaatgtgacatatttttagtcattact |
200 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
26192235 |
tcgagtaaggttacatgagtatacttctcctcatagtttattccacccttttggttatagctttttttccattaaatgtgacatatttttagtcattact |
26192136 |
T |
 |
| Q |
201 |
ctggttttatc |
211 |
Q |
| |
|
||||||||||| |
|
|
| T |
26192135 |
ctggttttatc |
26192125 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University