View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_high_27 (Length: 289)
Name: NF11733_high_27
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_high_27 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 268; Significance: 1e-150; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 268; E-Value: 1e-150
Query Start/End: Original strand, 7 - 278
Target Start/End: Original strand, 31589867 - 31590138
Alignment:
| Q |
7 |
gtgagatgaagagcagtaaccggatgcttatggaacttgagtaccttgcgtaggatcaatctgtattctggctcttttgcaccaaggtttaacactctga |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589867 |
gtgagatgaagagcagtaaccggatgcttatggaacttgagtaccttgcgtaggatcaatctgtattctggctcttttgcaccaaggtttaacactctga |
31589966 |
T |
 |
| Q |
107 |
acccacctgcacctgatttgctgagagagctatctgggtcagagcagtgaaccatttgccacactttgacagcaccactctgatggcctgttgcgtacca |
206 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31589967 |
acccacttgcacctgatttgctgagagagctatctgggtcagagcagtgaaccatttgccacactttgacagcaccactctgatggcctgttgcgtacca |
31590066 |
T |
 |
| Q |
207 |
ctttgtttcctgccaatcagaaaatctactgctcgtcactgagagaatagagtcagaaggcagttgtgatgt |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31590067 |
ctttgtttcctgccaatcagaaaatctactgctcgtcactgagagaatagagtcagaaggcagttgtgatgt |
31590138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University