View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF11733_high_28 (Length: 277)

Name: NF11733_high_28
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF11733_high_28
NF11733_high_28
[»] chr2 (2 HSPs)
chr2 (18-271)||(4547919-4548172)
chr2 (166-211)||(4548399-4548444)


Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 4547919 - 4548172
Alignment:
18 tccagttctcagttctcacctaaaattttgtactataacttttctgtttagattttgagatggtaaaatataaatgaacttgatttcttgcattattgtc 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4547919 tccagttctcagttctcacctaaaattttgtactataacttttctgtttagattttgagatggtaaaatataaatgaacttgatttcttgcattattgtc 4548018  T
118 tgtatgcagaatgataatagaagatctgaggaaagggaatggttgggagagaagcatcttgtacattattttgattatgaggtagagaacaaaaagtacg 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
4548019 tgtatgcagaatgataatagaagatctgaggaaagggaatggttgggagagaagcatcttgtacattattttgattatgaggtagagaacaaaaagtacg 4548118  T
218 tgatatgggctataacggctgcaattttaattagggctgctacccctttgcttc 271  Q
    ||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
4548119 tgatatgggctataacggctgcaattttaattagggctgctacccttttgcttc 4548172  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 4548399 - 4548444
Alignment:
166 gagaagcatcttgtacattattttgattatgaggtagagaacaaaa 211  Q
    |||||| |||||||||||||||||||||||||||||| ||||||||    
4548399 gagaagtatcttgtacattattttgattatgaggtagggaacaaaa 4548444  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University