View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_high_29 (Length: 270)
Name: NF11733_high_29
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_high_29 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 228; Significance: 1e-126; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 228; E-Value: 1e-126
Query Start/End: Original strand, 1 - 254
Target Start/End: Original strand, 7440063 - 7440313
Alignment:
| Q |
1 |
acaactttgattttagtgattggatccttcgttgcacgcgcctcaatgtagcattggaatttgtagctttgaacattctaaattcagatatgaatgcttt |
100 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
7440063 |
acaactttggttttagtgattggatccttcgttgcacgcgcctcaatgtagcattggaatttgtagctttgaacattctaaattcagatatgcatgcttt |
7440162 |
T |
|
| Q |
101 |
taattcatatggtgtgtcacactgctttttatactagtttgagttcaaagaaagaatgtaagataccttgttcattcttctgaagatgatgatgatacta |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
7440163 |
taattcatatggtgtgtcacactgctttttatactagtttgtgttcaaagaaagaatgtaagataccttgttcattcttctgaa---gatgatgatacta |
7440259 |
T |
|
| Q |
201 |
ttactgcggtttcctttttctttatttgtcacaaaatgtattgtacactcaatt |
254 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7440260 |
ttactgcggtttcctttttctttatttgtcacaaaatgtattgtacactcaatt |
7440313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University