View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_high_35 (Length: 235)
Name: NF11733_high_35
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_high_35 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 1 - 179
Target Start/End: Original strand, 2598764 - 2598946
Alignment:
| Q |
1 |
gtgtaaaccgcttgttttttaatgttctacatcatatgaatatgatgtatgtgtagagattttta----aatggttaagtttggatggatgcctgtattg |
96 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2598764 |
gtgtaaaccgcttgttttttaatgttctacatcatatgaatatgatgtatgtgtagagatttttatttaaatggttaaatttggatggatgcctgtattg |
2598863 |
T |
 |
| Q |
97 |
tcaaggcaaaaggagtagaaaattttgacatattacatggctctacgtggtttggtcgatttgacttcatagaaatggaatta |
179 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2598864 |
tcaaggcaaaaggagtagaaaattttgacatattacatggctctatgtggtttggtcgatttgacttcatagaaatggaatta |
2598946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 101 - 188
Target Start/End: Original strand, 10240186 - 10240272
Alignment:
| Q |
101 |
ggcaaaaggagtagaaaattttgacatattacatggctctacgtggtttggtcgatttgacttcatagaaatggaattatcttcaaag |
188 |
Q |
| |
|
|||||||||||||||| || | |||||||| |||| |||| ||||||||||| |||| ||||| |||||||||||||| |||||| |
|
|
| T |
10240186 |
ggcaaaaggagtagaatatctcaacatattatatggttctatgtggtttggtcaattt-cgttcatcgaaatggaattatcatcaaag |
10240272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University