View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_21 (Length: 373)
Name: NF11733_low_21
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_21 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 363
Target Start/End: Complemental strand, 103010 - 102648
Alignment:
| Q |
1 |
caatagccgttgatcctttgcttgttcgtttccttcgtccacatcagaggtaccaatccttctcaatcaattccnnnnnnnattgagtatgtatggtgta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |||||||||||| |
|
|
| T |
103010 |
caatagccgttgatcctttgcttgttcgtttccttcgtccacatcagaggtaccaatccttctcaatcaattcctttttttattgaggatgtatggtgta |
102911 |
T |
 |
| Q |
101 |
tatttgtaatctagactgtagtattatacatatgtcttgttacactataaaccctaattcactcatttattcctgtctacttctttgatgcagagaaggg |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
102910 |
tatttgtaatctagactgtagtattatacatatgtcttgttacactataaaacctaattcactcatttattcctgtctacttctttgatgcagagaaggg |
102811 |
T |
 |
| Q |
201 |
gttcaattcatgtttgattgtgtcgccggactatgtgagacacccgatatcaatggatgcattttggcagatgatatggggtgggtaacttcttattctt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
102810 |
gttcaattcatgtttgattgtgtcgccggactatgtgagacacccgatatcaatggatgcattttggcagatgatatggggtgggtaacttcttattctt |
102711 |
T |
 |
| Q |
301 |
tacaaagaaatctttacttttcttttcaatttcttcgtacttacctagtgctgcctgcctttg |
363 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
102710 |
tacaaagaaatctttagttttcttttcaatttcttcgtacttacctagggctgcctgcctttg |
102648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University