View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_23 (Length: 333)
Name: NF11733_low_23
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_23 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 303; Significance: 1e-170; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 303; E-Value: 1e-170
Query Start/End: Original strand, 1 - 315
Target Start/End: Original strand, 103004 - 103318
Alignment:
| Q |
1 |
gctattgttgtgaaattagaattagaagggtctttgtcgtgaagaggttgccagagtattagaggatcaatttcagggggcaaaggcggcgagggtttga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103004 |
gctattgttgtgaaattagaattagaagggtcgttgtcgtgaagaggttgccagagtattagaggatcaatttcagggggcaaaggcggcgagggtttga |
103103 |
T |
 |
| Q |
101 |
caacctcctctttgtgatcagagatattcaaatccaactccgtcaaaggtgtggtggaggtgggaataggaataggagtggtagaaccccatgggacaaa |
200 |
Q |
| |
|
|| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103104 |
cagcctcctctttgtgatcagagatattcaaatccaactccgtcaaaggtgtggtggaggtgggaataggaataggagtggtagaaccccatgggacaaa |
103203 |
T |
 |
| Q |
201 |
tcttttgcgagcagagagcctacgagcaagatcttgattattgttattgttgtaagcatcagacggtggtttaaacggttttctgcaaatagcggcagct |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
103204 |
tcttttgcgagcagagagcctacgagcaagatcttgattattgttattgttgtaagcatcggacggtggtttaaacggttttctgcaaatagcggcagct |
103303 |
T |
 |
| Q |
301 |
ccattggtggaatat |
315 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
103304 |
ccattggtggaatat |
103318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University