View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_24 (Length: 331)
Name: NF11733_low_24
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_24 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 263; Significance: 1e-146; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 263; E-Value: 1e-146
Query Start/End: Original strand, 3 - 313
Target Start/End: Complemental strand, 38495976 - 38495666
Alignment:
| Q |
3 |
atttctttttcttctctcccttgcctttaaccaccgtctccttcctttaccaagtgcagcacaaaaccatgttttctttatc--aagctctctgcagcaa |
100 |
Q |
| |
|
|||| |||||||||||| ||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
38495976 |
atttatttttcttctcttccttgcctttaaccaccgtctccttcctttaccaagtgcagtacaaaaccatgttttctttatccaaagctctctgcagcaa |
38495877 |
T |
|
| Q |
101 |
cactccggtctcaattgaaatgttccggcgatgaggtactggatttccggtctctcactctggtcgtctccgatccagtcgtccgttatcccaccgacat |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38495876 |
cactccggtctcaattgaaatgttccggcgatgaggtactggatttccggtctctcactccggtcgtctccgatccagtcgtccgttatcccaccgacat |
38495777 |
T |
|
| Q |
201 |
catcactgacaggttcgtagagaagattatcggaaggtgttgtttttggaaaagttgtcaccggtgtggttttagggatatgaacgggtcgtcggcggtg |
300 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||| |
|
|
| T |
38495776 |
cgtcactgacaggttcgtagagaagattatcggaaggtgttgtttttggaaaagttgtcaccggtgtggttttagtgatatga--cggtcgtcggcggtg |
38495679 |
T |
|
| Q |
301 |
tgagggagaagag |
313 |
Q |
| |
|
||||||||||||| |
|
|
| T |
38495678 |
tgagggagaagag |
38495666 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 201; Significance: 1e-109; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 201; E-Value: 1e-109
Query Start/End: Original strand, 1 - 313
Target Start/End: Complemental strand, 52113984 - 52113693
Alignment:
| Q |
1 |
taatttctttttcttctctcccttgcctttaaccaccgtctccttcctttaccaagtgcagcacaaaaccatgttttctttatc--aagctctctgcagc |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
52113984 |
taatttctttttcttctctcccttgcctttaaccaccgtctccttcctttac----------acaaaaccatgttttctttatccaaagctctctccagc |
52113895 |
T |
|
| Q |
99 |
aacactccggtctcaattgaaatgttccggcgatgaggtactggatttccggtctctcactctggtcgtctccgatccagtcgtccgttatcccaccgac |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||||||||||||| |
|
|
| T |
52113894 |
aacactccggtctcaattgaaatgttccggcgatgaggtactggatttccggtc-------------gtctccgatccagtcgtaagttatcccaccgac |
52113808 |
T |
|
| Q |
199 |
atcatcactgacaggttcgtagagaagattatcggaaggtgttgtttttggaaaagttgtcaccggtgtggttttagggatatgaacgggtcgtcggcgg |
298 |
Q |
| |
|
||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
52113807 |
atcgtcactgacaggttcgtagagaagattatcggaaggtgttgtttttggaaaagttgtcaccggtgtggttttagtgatatgaacaggtcgtcggcgg |
52113708 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University