View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_25 (Length: 326)
Name: NF11733_low_25
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_25 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 237; Significance: 1e-131; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 237; E-Value: 1e-131
Query Start/End: Original strand, 1 - 310
Target Start/End: Original strand, 3685860 - 3686176
Alignment:
| Q |
1 |
gttgtgtaacaagtgatagatgagacacatatagtttctcatgctgcaccactgccccctatgaacactgataagtctatcacat--------ttagcac |
92 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| | |
|
|
| T |
3685860 |
gttgcgtaacaagtgatagatgagacacatatagtttctcatgctgcaccactgccccttatgaacactgataagtctatcacatcttttcatttagcgc |
3685959 |
T |
|
| Q |
93 |
tacaaactgtcacatatgagattgagagaacaacaaatactgagaaaaaattcccgagtttggaattgataaccgttaatgcacatatggatgcttcaga |
192 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||||||||| |
|
|
| T |
3685960 |
tacaaaatgtcacatatgagattgagagaacaacaaatactgagaaaaaattcccgagtttggaattggtaaccgttaatgaacatatggatgcttcaga |
3686059 |
T |
|
| Q |
193 |
ttcggcagaaaatgtatcaaatgatagcgcagaattcaaatgctaaagcttctattggtcattcttcgtccattgcaatcatttgtccgcaacttcagag |
292 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| || |||| |||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3686060 |
ttcggcataaaatgtatcaaatgatagcgcagaagtc-aatgttaaagcttctattggtcattcttcgtccattgcaatcatttgtctgcaacttcagaa |
3686158 |
T |
|
| Q |
293 |
ggaacttgatcttgtaaa |
310 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
3686159 |
ggaacttgatcttgtaaa |
3686176 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University