View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_31 (Length: 277)
Name: NF11733_low_31
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_31 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 18 - 271
Target Start/End: Original strand, 4547919 - 4548172
Alignment:
| Q |
18 |
tccagttctcagttctcacctaaaattttgtactataacttttctgtttagattttgagatggtaaaatataaatgaacttgatttcttgcattattgtc |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4547919 |
tccagttctcagttctcacctaaaattttgtactataacttttctgtttagattttgagatggtaaaatataaatgaacttgatttcttgcattattgtc |
4548018 |
T |
 |
| Q |
118 |
tgtatgcagaatgataatagaagatctgaggaaagggaatggttgggagagaagcatcttgtacattattttgattatgaggtagagaacaaaaagtacg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4548019 |
tgtatgcagaatgataatagaagatctgaggaaagggaatggttgggagagaagcatcttgtacattattttgattatgaggtagagaacaaaaagtacg |
4548118 |
T |
 |
| Q |
218 |
tgatatgggctataacggctgcaattttaattagggctgctacccctttgcttc |
271 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4548119 |
tgatatgggctataacggctgcaattttaattagggctgctacccttttgcttc |
4548172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 166 - 211
Target Start/End: Original strand, 4548399 - 4548444
Alignment:
| Q |
166 |
gagaagcatcttgtacattattttgattatgaggtagagaacaaaa |
211 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
4548399 |
gagaagtatcttgtacattattttgattatgaggtagggaacaaaa |
4548444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University