View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_33 (Length: 265)
Name: NF11733_low_33
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_33 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 132 - 260
Target Start/End: Complemental strand, 17292094 - 17291966
Alignment:
| Q |
132 |
attatctcaatcatatttgtatttattgaatgtatgtgtattaaattattaattgttgtttggaagaaaattattactcaacatgatgtgtgatggtctt |
231 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||| || |
|
|
| T |
17292094 |
attatcttaatcatatttgtatttattgaatgtatgtgtattaaattattaattgttgtttagaagaaaaatattactcaacatgatgtgtgatggtttt |
17291995 |
T |
|
| Q |
232 |
ttttaaagactaattctagctctgctcct |
260 |
Q |
| |
|
||| |||||||||||||||||||| |||| |
|
|
| T |
17291994 |
tttgaaagactaattctagctctggtcct |
17291966 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 19 - 112
Target Start/End: Complemental strand, 17292247 - 17292154
Alignment:
| Q |
19 |
gtgggatagatggcacaatcgctaatgaaatctgtcactcaaactaccgctggtggaattcagaaacaacgatatcgcaacgttaatttccagt |
112 |
Q |
| |
|
||||||||||||| ||||| |||||| ||||||| ||||| ||||||||||||||||| |||||||||||||||||||||| ||||||| |||| |
|
|
| T |
17292247 |
gtgggatagatggtacaattgctaatcaaatctgccactcgaactaccgctggtggaactcagaaacaacgatatcgcaacattaatttgcagt |
17292154 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University