View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_34 (Length: 252)
Name: NF11733_low_34
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_34 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 147; Significance: 1e-77; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 11 - 165
Target Start/End: Complemental strand, 44188836 - 44188682
Alignment:
| Q |
11 |
caaaggcccctgaaacaatacaagtccctctatgtccttcggtgttggcattaaagacaagttgcacaaatagatgactggcagcaaccaattcctagga |
110 |
Q |
| |
|
|||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188836 |
caaaggtcactgaaacaatacaagtccctctatgtccttcggtgttggcattaaagacaagttgcacaaatagatgactggcagcaaccaattcctagga |
44188737 |
T |
 |
| Q |
111 |
cacaacaggtgctgagaatgcttttgcaagagtagtgtactacctatggtataat |
165 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188736 |
cacaacaggtgctgagaatgcttttgcaagagtagtgtactacctatggtataat |
44188682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 165 - 239
Target Start/End: Complemental strand, 44188645 - 44188571
Alignment:
| Q |
165 |
tcttatacgaattcggaatcggggacccgagattggttattgtatgaacaaggtatggcaaattatgtcccaact |
239 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
44188645 |
tcttatacgaattcggaatcggggacccgagattggttattgtatgaacaaggtatggcaaattatgtcccaact |
44188571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University