View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11733_low_41 (Length: 231)
Name: NF11733_low_41
Description: NF11733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11733_low_41 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 175; Significance: 2e-94; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 175; E-Value: 2e-94
Query Start/End: Original strand, 18 - 216
Target Start/End: Complemental strand, 29292743 - 29292546
Alignment:
| Q |
18 |
gtgttcaaagactcacattagattagataaaacattaaaataaatttataattgagaaatatctctctttctacttgttggttttgttgttttaagttag |
117 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
29292743 |
gtgttcaaagactcacattagattagataaaacattaaaataaatttataagtgagaaatatctctctttctactcgttggttttgttgttttaagttag |
29292644 |
T |
 |
| Q |
118 |
attcaatacaaaatctaatacgatactagagcttatcttaatacctacttgaccatcagatatcgagccactcaagtcacactttaaaggtagcctatg |
216 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||| ||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
29292643 |
attcaatacaaaatctaatacgatactagagcttatc-taatatctacttgaccatcggatatcgagccactcaagtcacactttaaaggtagcctatg |
29292546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University