View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11734_high_30 (Length: 243)
Name: NF11734_high_30
Description: NF11734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11734_high_30 |
 | |
|
| [»] scaffold0147 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0147 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 8 - 243
Target Start/End: Complemental strand, 18396 - 18156
Alignment:
| Q |
8 |
atggacatcaatgattttgtatttgaactaaatattgacaatatcaacttggtcaaattgctaacatacataaaggaaagcaatatcatgcacaaggt-- |
105 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
18396 |
atggccatcaatgattttgtatttgaactaaatattgataatatcaacttggtcaaattgctaacgtacataaaggaaagcaatatcatgcacaaggtga |
18297 |
T |
|
| Q |
106 |
---tcgctactaaatattttaattttcttctgacacaacagaattccatgtgatgcttctgaatcttctgttgtcattttttgatgtaaaagtttacttt |
202 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
18296 |
atctcgctactaaatattttaattttcttctgacacaacagaattccatgtgatgcttctgaatcttctgttgtcatttttttatgtaaaagtttacttt |
18197 |
T |
|
| Q |
203 |
attttccaggttagtggttatggagaaaagatggctacatt |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18196 |
attttccaggttagtggttatggagaaaagatggctacatt |
18156 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University