View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11734_high_32 (Length: 240)
Name: NF11734_high_32
Description: NF11734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11734_high_32 |
 |  |
|
| [»] scaffold0147 (1 HSPs) |
 |  |
|
Alignment Details
Target: scaffold0147 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: scaffold0147
Description:
Target: scaffold0147; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 16 - 240
Target Start/End: Original strand, 17827 - 18051
Alignment:
| Q |
16 |
catgtgcttcatctacaatctattgaaattttcaaagttatcatttatgttacccattatttgtaaggaaaataaaatagcactataaagtccttttcta |
115 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
17827 |
catgtgcttcatctacaatctattgaaagtttcaaagttatcatttatgttacccattatttgtaagtaaaataaaatagcactataaagtccttttcta |
17926 |
T |
 |
| Q |
116 |
attaacacaaacctcagagaaaatcttctctgcactgagcataacatatttaatatatccttgaccttgcttccttgagcttgttgaactagacctggaa |
215 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17927 |
attaacacaaacctcggagaaaatcttctctgcactgagcataacatatttaatatatccttgaccttgcttccttgagcttgttgaactagacctggaa |
18026 |
T |
 |
| Q |
216 |
attatcatccgtccatcactgtcct |
240 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
18027 |
attatcatccgtccatcactgtcct |
18051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University