View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11734_low_13 (Length: 388)
Name: NF11734_low_13
Description: NF11734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11734_low_13 |
 | |
|
| [»] scaffold0102 (2 HSPs) |
| |
|
Alignment Details
Target: scaffold0102 (Bit Score: 143; Significance: 5e-75; HSPs: 2)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 143; E-Value: 5e-75
Query Start/End: Original strand, 218 - 388
Target Start/End: Original strand, 35109 - 35279
Alignment:
| Q |
218 |
actagagtagtaggtgaggcagaggccttccaacctaattacactacggtgatacctgaactttttatagataacaacctcaacaaaaatacacctttag |
317 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||| |||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35109 |
actagaatagtaggtcaggcagaggccttccaacctaatgacactaaggtgatacctgaactttttatagataacaatctcaacaaaaatacacctttag |
35208 |
T |
|
| Q |
318 |
atgtcattagtgatgaaggtagaatacattgcaatacaatgcttgaaaacatgttgaataaatactggttc |
388 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
35209 |
atgtcattagtgaggaaggtagaatacattgcaatacaatgcttgaaaacatgttgaataaatacgggttc |
35279 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102; HSP #2
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 18 - 133
Target Start/End: Original strand, 34979 - 35094
Alignment:
| Q |
18 |
ctaaacccatgggattttcatatgagcctgtagaagtggtgatcatgataaagactatagatcacttagccataggaaaccaacagatgaaggaccaggt |
117 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| || |
|
|
| T |
34979 |
ctaaagccatgggattttcatatgagcctgtagaagtggtgatcatgataaagactatagatcacttagccctaggaaaccaacagatgaaggaccaagt |
35078 |
T |
|
| Q |
118 |
aagaatgctgtaactc |
133 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
35079 |
aagaatgttgtaactc |
35094 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University