View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11734_low_18 (Length: 305)
Name: NF11734_low_18
Description: NF11734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11734_low_18 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 119; Significance: 8e-61; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 119; E-Value: 8e-61
Query Start/End: Original strand, 139 - 290
Target Start/End: Complemental strand, 34149361 - 34149198
Alignment:
| Q |
139 |
ttgccagattattgttcgatacttgaaggtgatgaatcatatagttgctggcaggcttattttgagctcaaagatctccaagtatgtaatctctttcttc |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149361 |
ttgccagattattgttcgatacttgaaggtgatgaatcatatagttgctggcaggcttattttgagctcaaagatctccaagtatgtaatctctttcttc |
34149262 |
T |
 |
| Q |
239 |
t------------tctttgtttcagatataactcattcaagattttgcgttttccctgtttttt |
290 |
Q |
| |
|
| ||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
34149261 |
ttcttcttcttcttctttgtttcagatataactcattcaagattttgcgttttccctgattttt |
34149198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 20 - 73
Target Start/End: Complemental strand, 34149476 - 34149423
Alignment:
| Q |
20 |
ctaaagaccttcctttgatcgaaaaatctgagaaagatctcttgggtgcgttcc |
73 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34149476 |
ctaaagaccttcctttgatcgaaaaatctgagaaagatctcttgggtgcgttcc |
34149423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University