View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11734_low_27 (Length: 248)
Name: NF11734_low_27
Description: NF11734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11734_low_27 |
 | |
|
| [»] chr7 (2 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 201 - 234
Target Start/End: Complemental strand, 40725799 - 40725766
Alignment:
| Q |
201 |
catcaccatttcagtttcaaatgcaaattcaaca |
234 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
40725799 |
catcaccatttcagtttcaaatgcaaattcaaca |
40725766 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 32; Significance: 0.000000005; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Complemental strand, 12912637 - 12912590
Alignment:
| Q |
201 |
catcaccatttcagtttcaaatgcaaattcaacatcagaccagtgtaa |
248 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
12912637 |
catcaccatttcagtttcaaattcaaattcaacaacagataagtgtaa |
12912590 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 201 - 248
Target Start/End: Original strand, 12923406 - 12923453
Alignment:
| Q |
201 |
catcaccatttcagtttcaaatgcaaattcaacatcagaccagtgtaa |
248 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |||| ||||||| |
|
|
| T |
12923406 |
catcaccatttcagtttcaaattcaaattcaacaacagataagtgtaa |
12923453 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University