View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11734_low_29 (Length: 243)
Name: NF11734_low_29
Description: NF11734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11734_low_29 |
 | |
|
| [»] scaffold0102 (1 HSPs) |
| |
|
Alignment Details
Target: scaffold0102 (Bit Score: 216; Significance: 1e-119; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 216; E-Value: 1e-119
Query Start/End: Original strand, 12 - 243
Target Start/End: Complemental strand, 35527 - 35296
Alignment:
| Q |
12 |
acatcatagtgcttcattctttcattcacatctttaaacccatggccaatgttcttcttcagagatataactttagtgagagttgtgagagatacagctc |
111 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35527 |
acatcatagtgcttcattctttcattcacatctttaaacccatggccaatgttcttcttcagagatataactttagtgagagttgtgagagatacagctc |
35428 |
T |
|
| Q |
112 |
taaaccatttaagatttctaagacatagcttcggtctagagcctatagatttctccaccactacgggctttctcttctgagttttataacacttccattg |
211 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
35427 |
taaaccatttaagatttttaagacatagcttcggtctagaacctatagatttctcccccactacgggctttctcttctgagttttataacacttccattg |
35328 |
T |
|
| Q |
212 |
cttaactttagacttagtagaatgataggtat |
243 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |
|
|
| T |
35327 |
cttaactttagactttgtagaatgataggtat |
35296 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University