View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11736_high_4 (Length: 387)
Name: NF11736_high_4
Description: NF11736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11736_high_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 355; Significance: 0; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 355; E-Value: 0
Query Start/End: Original strand, 1 - 359
Target Start/End: Original strand, 49087397 - 49087755
Alignment:
| Q |
1 |
caaacctgctggtccaccaccttctccttcctacggcacaagttcttccggacgtgcttttgccacattcctcaccatctttctcctactaatcggtgtc |
100 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087397 |
caaacctgctggtccaccaccttcttcttcctacggcacaagttcttccggacgtgcttttgccacattcctcaccatctttctcctactaatcggtgtc |
49087496 |
T |
 |
| Q |
101 |
actctacttgttctctggcttgtctaccgtccacacaaaccccacttcacggttgtcggtgctgccatctatggcttcaacacaacctcaccaccgctcc |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087497 |
actctacttgttctctggcttgtctaccgtccacacaaaccccacttcacggttgtcggtgctgccatctatggcttcaacacaacctcaccaccgctcc |
49087596 |
T |
 |
| Q |
201 |
tttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtctctgcttactatgacaggttctctgcttttgtgtcctataggaacca |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087597 |
tttccgccaccttgcagttcaacatcctcattaagaacccaaacaagcgtgtctctgcttactatgacaggttctctgcttttgtgtcctataggaacca |
49087696 |
T |
 |
| Q |
301 |
agccataacaccgcaggttatgcttccgccgctgttcctggagaagcacagtcaggtgt |
359 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49087697 |
agccataacaccgcaggttatgcttccgccgctgttcctggagaagcacagtcaggtgt |
49087755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University