View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11736_high_6 (Length: 320)
Name: NF11736_high_6
Description: NF11736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11736_high_6 |
 |  |
|
| [»] chr4 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 270; Significance: 1e-151; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 270; E-Value: 1e-151
Query Start/End: Original strand, 31 - 320
Target Start/End: Original strand, 52987858 - 52988147
Alignment:
| Q |
31 |
aaactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcat |
130 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987858 |
aaactaccagcccctgaatgtccatgcctgccacagcattccttcatgtagctcttgcaacatccaccaacttctctcttgtcaaaactaatgcaagcat |
52987957 |
T |
 |
| Q |
131 |
gcataattgacgattcgatcgattcctttgaatagccctcattcttgcatcatggactaacttccctctcatttggaccctcacagccaccacacacaac |
230 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52987958 |
gcataattgacgattctatcgattcctttgaatagccctcattcttgcaacatggactaacttccctctcatttggaccctcacagccaccacacacaac |
52988057 |
T |
 |
| Q |
231 |
aggcaatttggggcagtctgtacaagaatctttttctttctctgccggacttgaacaaccatgcatcgaggctaattcaacgtgctcggt |
320 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52988058 |
aggcaatttggggcagtctttacaagaatctttttctttctctgccagatttgaacaaccatgcatcgaggctaattcaacgtgctcggt |
52988147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University