View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11736_low_2 (Length: 229)
Name: NF11736_low_2
Description: NF11736
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11736_low_2 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 193; Significance: 1e-105; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 211
Target Start/End: Complemental strand, 3115411 - 3115219
Alignment:
| Q |
19 |
gtttctgtagctggtgctgttattgcaagaacttttgtaattagaaacaatgagaaccctgtttggaatcagcacttcaatgtacctgttgcacatcttg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3115411 |
gtttctgtagctggtgctgttattgcaagaacttttgtaattagaaacaatgagaaccctgtttggaatcagcacttcaatgtacctgttgcacatcttg |
3115312 |
T |
 |
| Q |
119 |
catcagaaattcactttgttgtaaaagacaatgatattgttggttcacaggttattggtgcagttggaattccagtagaaaaattatgtgatg |
211 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3115311 |
catcagaaattcactttgttgtaaaagacaatgatattgttggttcacaggttattggtgcagttggaattccagtagaaaaattatgtgatg |
3115219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 115; E-Value: 1e-58
Query Start/End: Original strand, 17 - 211
Target Start/End: Complemental strand, 3121269 - 3121075
Alignment:
| Q |
17 |
cagtttctgtagctggtgctgttattgcaagaacttttgtaattagaaacaatgagaaccctgtttggaatcagcacttcaatgtacctgttgcacatct |
116 |
Q |
| |
|
|||||||||| ||||||||||| ||||| ||||||| ||| || ||||| |||||||||||||||||| || || || ||||||||||||||||||| |
|
|
| T |
3121269 |
cagtttctgtggctggtgctgtgattgctagaacttctgtgatcagaaatgatgagaaccctgtttggatgcaacattttaatgtacctgttgcacatca |
3121170 |
T |
 |
| Q |
117 |
tgcatcagaaattcactttgttgtaaaagacaatgatattgttggttcacaggttattggtgcagttggaattccagtagaaaaattatgtgatg |
211 |
Q |
| |
|
|||||||| |||||||||||||||||||||| ||||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
3121169 |
agcatcagagattcactttgttgtaaaagacagtgatattgttggttcacagcttattggtgcagttggaattccagttgaaaagttatgtgatg |
3121075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University