View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_high_37 (Length: 385)
Name: NF11737A_high_37
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_high_37 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 155; Significance: 3e-82; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 155; E-Value: 3e-82
Query Start/End: Original strand, 20 - 193
Target Start/End: Original strand, 30471998 - 30472172
Alignment:
| Q |
20 |
catcactcaattgatcctaatatgtccaatttaattaccttcatccatccttaaatataaaacctccatccatcgatttgtggtttttgtggacggg-tt |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| || |
|
|
| T |
30471998 |
catcactcaattgatcctaatatgtccaatttaattaccttcatccatccttaaatataaaaccaccatccatcgatttgtggtttttgtggacgggttt |
30472097 |
T |
|
| Q |
119 |
tcgttcgagtagcagaagataagtgtttggatctcgtttggagatttgcaatggtggttgaagatttggctcaca |
193 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472098 |
tcgttcgagtagtggaagataagtgtttggatctcgtttggagatttgcaatggtggttgaagatttggctcaca |
30472172 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 291 - 385
Target Start/End: Original strand, 30472270 - 30472364
Alignment:
| Q |
291 |
agttgagtgatatttttgtcagtgatttgatgtccgaagtgtatggattttctgttggatgttccgcctatctacgtcaccttttacttgttttt |
385 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
30472270 |
agttgagtgatatttttgtcggtgatttgatgtccgaagtgtatggattttctgttgggtgttccgcctatctacgtcaccttttacttgttttt |
30472364 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University