View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_high_75 (Length: 264)
Name: NF11737A_high_75
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_high_75 |
 |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0018 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0072 (2 HSPs) |
 |  |  |
|
| [»] scaffold1112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0011 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
| [»] scaffold0007 (1 HSPs) |
 |  |  |
|
| [»] scaffold0460 (1 HSPs) |
 |  |  |
|
| [»] scaffold0445 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0157 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0108 (1 HSPs) |
 |  |  |
|
| [»] scaffold1372 (1 HSPs) |
 |  |  |
|
| [»] scaffold0687 (1 HSPs) |
 |  |  |
|
| [»] scaffold0204 (1 HSPs) |
 |  |  |
|
| [»] scaffold0005 (1 HSPs) |
 |  |  |
|
| [»] scaffold0003 (1 HSPs) |
 |  |  |
|
| [»] scaffold0707 (1 HSPs) |
 |  |  |
|
| [»] scaffold0339 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0128 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold0015 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (1 HSPs) |
 |  |  |
|
| [»] scaffold0533 (1 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0187 (2 HSPs) |
 |  |  |
|
| [»] scaffold0121 (2 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0238 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0020 (1 HSPs) |
 |  |  |
|
| [»] scaffold0087 (1 HSPs) |
 |  |  |
|
| [»] scaffold0063 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold0034 (1 HSPs) |
 |  |  |
|
| [»] scaffold0013 (1 HSPs) |
 |  |  |
|
| [»] scaffold1787 (1 HSPs) |
 |  |  |
|
| [»] scaffold1709 (1 HSPs) |
 |  |  |
|
| [»] scaffold1331 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0608 (1 HSPs) |
 |  |  |
|
| [»] scaffold0250 (1 HSPs) |
 |  |  |
|
| [»] scaffold0227 (1 HSPs) |
 |  |  |
|
| [»] scaffold1990 (1 HSPs) |
 |  |  |
|
| [»] scaffold0294 (1 HSPs) |
 |  |  |
|
| [»] scaffold0275 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold1086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0026 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr6 (Bit Score: 104; Significance: 6e-52; HSPs: 187)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 104; E-Value: 6e-52
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 6228358 - 6228235
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6228358 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
6228259 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
6228258 |
ctctagccactaggctacttgacc |
6228235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 17216955 - 17217077
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||||||||||| ||||||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
17216955 |
ccatgagcttagctcatttggtaagggataatgcataatatgtgtaggggtcggagttcgaactccggacaccccacttattcatctttaaggtgaattt |
17217054 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
17217055 |
ctctagccactaggctacttgac |
17217077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 18903465 - 18903342
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||| || |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18903465 |
ccatgagcttagctcatttggcaagggataatacacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
18903366 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
18903365 |
ctctagccactaggctacttgacc |
18903342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 93 - 221
Target Start/End: Complemental strand, 20415666 - 20415537
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||| ||||||| ||| ||||||| |||||| |||||||| |||||||||||||| | ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
20415666 |
caatccccatgagtttagctcattttgtaagggataatgcacaatatgtgcaggggccagggttcgaaccccggacaccccacttattcatctttaaggt |
20415567 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |
|
|
| T |
20415566 |
gaatttctctagccactaggctgcttgacc |
20415537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 3974439 - 3974561
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||| ||||||||||||||||||||||||||| ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
3974439 |
ccatgagcttaactcatttggtatgggtaatgcagaatatgtgcaggggtcggggttcgaacttcggactccccacttattcatctttaaggtgaatttc |
3974538 |
T |
 |
| Q |
199 |
tctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| | ||||||||| |||||| |
|
|
| T |
3974539 |
tctaactactaggctatttgacc |
3974561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 4854404 - 4854282
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||| | ||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4854404 |
ccatgagcttagctcatttggcaagggataatgtacaatgtgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtaaattt |
4854305 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||| ||||||||| |
|
|
| T |
4854304 |
ctctaaccactagcctacttgac |
4854282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 101 - 210
Target Start/End: Complemental strand, 24794991 - 24794881
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||||||||||||||| ||| ||||||||||||||| ||||||||||||| |||||| ||||||||| |
|
|
| T |
24794991 |
atgagcttagctcatttggtaagggataatgcacaatatgtgcaggggttgggattcgaaccccggacatcccacttattcatatttaagatgaatttct |
24794892 |
T |
 |
| Q |
200 |
ctagccactag |
210 |
Q |
| |
|
||||||||||| |
|
|
| T |
24794891 |
ctagccactag |
24794881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 112 - 220
Target Start/End: Complemental strand, 29322061 - 29321952
Alignment:
| Q |
112 |
tcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| |||||||||||||| |||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
29322061 |
tcatttggtaagggataatgcacaatatgtgcaggggctggggttcgaaccccagacatcccacttatttatctttaaggtgaatttctctagccactag |
29321962 |
T |
 |
| Q |
211 |
gctacttgac |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
29321961 |
actacttgac |
29321952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 105 - 220
Target Start/End: Original strand, 19748102 - 19748217
Alignment:
| Q |
105 |
gcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctag |
203 |
Q |
| |
|
||||| |||||||||||||| |||||||| ||||||||||||| | |||||||||||| |||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
19748102 |
gcttagctcatttggtaagggataatgcacaatatgtgcagggattggggttcgaaccacggacaccccacttattcat-tttaaggtgaatttctctga |
19748200 |
T |
 |
| Q |
204 |
ccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
19748201 |
ccactaggctacttgac |
19748217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 1128517 - 1128392
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat---tcatctttaaggtgaa |
194 |
Q |
| |
|
|||||| |||| |||||||| ||||| |||||||||||||||||||||||| |||||||||||||| ||||||||| |||| |||||||||||||||| |
|
|
| T |
1128517 |
ccatgaccttaactcatttgataagggataatgcataatatgtgcaggggttggggttcgaaccccagacaccccatttattcatcatctttaaggtgaa |
1128418 |
T |
 |
| Q |
195 |
tttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||| ||||||||| |
|
|
| T |
1128417 |
tttctctagtcactagactacttgac |
1128392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 30422206 - 30422084
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| | |||||||| ||||||| |||||||||| ||||||||| || ||||| || |||||||||||||| |
|
|
| T |
30422206 |
ccatgagcttaactcatttggtaagggataatgtacaatatgtgtaggggtccgggttcgaactccggacaccacatttatttatttttaaggtgaattt |
30422107 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
30422106 |
ctctggccactaggctacttgac |
30422084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 102 - 217
Target Start/End: Complemental strand, 7955018 - 7954901
Alignment:
| Q |
102 |
tgagcttatctcattt-ggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||| |||||||||||||| || ||| ||||||||| ||| |||||||||||||||||||| ||||||||| |
|
|
| T |
7955018 |
tgagcttaactcattttggtaagggataatgcacaatatgtgcagggggcgaggtgcgaaccccgaacatcccacttattcatctttaagatgaatttct |
7954919 |
T |
 |
| Q |
200 |
ctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
7954918 |
ctagccactaggctactt |
7954901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 15717111 - 15716984
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
15717111 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccgggcacggacacctcacttattcat-tttaaggt |
15717013 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
15717012 |
gaatttctctagccactaggctatttgac |
15716984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 103 - 208
Target Start/End: Original strand, 31637345 - 31637451
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| ||||||||||| || |||||||| ||||| ||||||||||||||||||| || ||||||||| ||||||| || |||||||||||||||||| |
|
|
| T |
31637345 |
gagcttaactcatttggtatgggataatgcacaatatttgcaggggtcggggttcgagcctcggacaccctacttatttatttttaaggtgaatttctct |
31637444 |
T |
 |
| Q |
202 |
agccact |
208 |
Q |
| |
|
||||||| |
|
|
| T |
31637445 |
agccact |
31637451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 11552873 - 11552990
Alignment:
| Q |
104 |
agcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||| ||||||||| |||| |||| | | ||| |||||||||| ||||||||||||||| | ||||||||||||||||||||||||| ||||| |||| |
|
|
| T |
11552873 |
agcttagctcatttggcaagggataacgtacaatgtgtgcaggggccggggttcgaaccccaggcaccccacttattcatctttaaggtaaatttttcta |
11552972 |
T |
 |
| Q |
203 |
gccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
11552973 |
gccactagtctacttgac |
11552990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 105 - 220
Target Start/End: Complemental strand, 5641781 - 5641666
Alignment:
| Q |
105 |
gcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctag |
203 |
Q |
| |
|
||||| |||| ||||||| |||||||||||||| | |||||| |||||||||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
5641781 |
gcttaactcacttggtaatggataatgcataatttatgcaggac-cggggttcgaactccggacaccccacttattcacctttaaggtgaatttctctag |
5641683 |
T |
 |
| Q |
204 |
ccactaggctacttgac |
220 |
Q |
| |
|
|| |||| ||||||||| |
|
|
| T |
5641682 |
ccgctagactacttgac |
5641666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 19221697 - 19221819
Alignment:
| Q |
99 |
ccatgagcttatctcatttggt-aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||||| ||| ||||||||||| ||||||||||| | ||||||||| || ||||||||| || ||||| |||||||||||||| |
|
|
| T |
19221697 |
ccatgagtttaactcatttggtgaagaataatgcataacatgtgcaggggctgaggttcgaactccagacaccccatttgttcatttttaaggtgaattt |
19221796 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
19221797 |
ctctagccactagattacttgac |
19221819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 102 - 199
Target Start/End: Complemental strand, 20568351 - 20568252
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatct--ttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| |||| |||||||||| | |||||||||| ||||||||||||||||||||||||| |||||||||||||||| || | ||||||||||||| |
|
|
| T |
20568351 |
tgagcttagctcagttggtaaggacattgcataatatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataaaggtgaatttct |
20568252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 127 - 221
Target Start/End: Original strand, 9763461 - 9763554
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| |||| ||| |||||||| ||||||| | |||||||||||||| ||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9763461 |
aatgcatattatatgcatgggccggggttccaaccccgaaaaccccacttattca-ctttaaggtgaatttctctagccactatgctacttgacc |
9763554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 11611418 - 11611488
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||||||||||||||| | ||||||||||||| |
|
|
| T |
11611418 |
ggggttcgaaccctggacaccccacttattcatctttaatgtgaatttctctagcaattaggctacttgac |
11611488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 129 - 220
Target Start/End: Complemental strand, 6658610 - 6658521
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| |||||||| |||||||||||||||||||||||||||||||| ||| || | ||||| |||||||||||||||||||||| |
|
|
| T |
6658610 |
tgcataatatatgcaggggccggggttcgaaccccggacaccccacttattctccttaaaagagaatt--tctagccactaggctacttgac |
6658521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 99 - 198
Target Start/End: Complemental strand, 18618637 - 18618538
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||| ||||||| | |||| |||||||||| |||||||||||||||||||||||||||| |||||||| |
|
|
| T |
18618637 |
ccatgagcttagctcatttggtaaaagataatgcacaatatgtataagggttggggttcgaatcccggacaccccacttattcatctttaa-gtgaattt |
18618539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 121 - 209
Target Start/End: Complemental strand, 25091174 - 25091086
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||| ||| ||| ||||| ||||||||| ||| ||||||||||||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
25091174 |
aaggataatgcacaatttgttcagggaccggggttcgtacctcggacaccccacttattcatcttaaaggtgattttctctagccacta |
25091086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 3294768 - 3294847
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
3294768 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccacttcttca |
3294847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 3200181 - 3200059
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| || |||||||||||| ||||||| ||||||| | || | | |||||||| |||||| || | ||||||||||||||||||||||| |
|
|
| T |
3200181 |
ccatgagcttaacttatttggtaaggaataatgcacaatatgtatatggattgaagttcgaacttcggacagccaatttattcatctttaaggtgaattt |
3200082 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| ||||||||||||| |
|
|
| T |
3200081 |
ctctagccaataggctacttgac |
3200059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 106 - 219
Target Start/End: Original strand, 7164699 - 7164812
Alignment:
| Q |
106 |
cttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
|||| |||||||| ||||| ||||||||| ||| || ||||| ||| |||||||||||| ||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
7164699 |
cttagctcatttgataagggataatgcatt-tatatgtaggggccggagttcgaaccccgaccaccccacttattcacctttaaggtgaatttctctagc |
7164797 |
T |
 |
| Q |
205 |
cactaggctacttga |
219 |
Q |
| |
|
| |||| |||||||| |
|
|
| T |
7164798 |
cgctagactacttga |
7164812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 5757924 - 5757847
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| ||||||||||||||| ||||| |||||||||| |||||||||||||||||||||| | |||||||||||| |
|
|
| T |
5757924 |
aggggttggggttcgaaccccgaacacctcacttattcacatttaaggtgaatttctctagccgccaggctacttgac |
5757847 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 3448392 - 3448470
Alignment:
| Q |
141 |
gcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
3448392 |
gcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaat---tctagccaataggctacctgacc |
3448470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 203
Target Start/End: Original strand, 5948887 - 5948973
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggtgaatttctctag |
203 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
5948887 |
ggataatgcacgatatgtgcaggggtcggggttcgaaccccgggcacgggcacctcacttattcatctttaaggtgaatttctctag |
5948973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 7897185 - 7897110
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| |||||| |||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7897185 |
tgagcttagatcagttggtagggataaatgcataatatatgcaggggtcggggttcgaaccccggacaccccactt |
7897110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 2251842 - 2251916
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2251842 |
tgagcttagctcagttggtagggatattgcatactatatgcaggggccggggttcgaaccccggacaccccactt |
2251916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 25045737 - 25045864
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggaca----ccccacttattcatctttaaggtga |
193 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| || |||||||||||||| | ||||| ||| || |||| || |||||||||||| |||| |||| |
|
|
| T |
25045737 |
ccatgagcttagctcatttggtaagggataattcacaatatgtgcaggggctgaggttcaaactccagacagacacctcacttattcatcattaacgtga |
25045836 |
T |
 |
| Q |
194 |
atttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| |||| |||||||||||||||||| |
|
|
| T |
25045837 |
atttttctaaccactaggctacttgacc |
25045864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 22983619 - 22983676
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
22983619 |
tgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaatt |
22983676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 23804789 - 23804732
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
23804789 |
tgcaggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaatt |
23804732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 25020584 - 25020505
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
25020584 |
tgcaggggcctgggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
25020505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 9438341 - 9438419
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||| ||||| ||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
9438341 |
tgcaggggttggggttcgaaccccggacaccccactcattcaccttataaggtgaat---tctaaccactaggctacttgac |
9438419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 492906 - 492980
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| ||||||| |||||| ||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
492906 |
tgagcttagctcagttggcaaggatattgcatattatatgcaggggccggggttcgaaccctggacaccccactt |
492980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 9372267 - 9372193
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
9372267 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccactt |
9372193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 10517203 - 10517277
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10517203 |
tgagcttagctcagttggtatggatattgcattttatatgcaggggtcggggttcgaaccccggacactccactt |
10517277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 15091452 - 15091526
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
15091452 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaatcccggacaccccactt |
15091526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17454811 - 17454737
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| |||||| |||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
17454811 |
tgagcttatctcagttggtagagatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
17454737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 28536266 - 28536144
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||| |||| | ||| | |||||||||||||| ||| ||| ||| | ||||||| |||||||||||||||| ||||||||| |
|
|
| T |
28536266 |
ccatgagcttagctcatttggcaagggaaaatatacaatatgtgcaggggccggtgtttgaatctcggacacttcacttattcatctttacggtgaattt |
28536167 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
| || ||||||| ||||||||| |
|
|
| T |
28536166 |
atttaaccactagactacttgac |
28536144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 31705903 - 31705977
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| |||| || ||||||||||||||||||| |||||||||||||| |
|
|
| T |
31705903 |
tgagcttagctcagttggtatggatattgcattatatatgtaggggtcggggttcgaaccacggacaccccactt |
31705977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 31935103 - 31935177
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
31935103 |
tgagcttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccactt |
31935177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 198
Target Start/End: Original strand, 32344678 - 32344736
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||||||| |||||| ||||||||| |
|
|
| T |
32344678 |
tgcaggggttggggttcgaactccggacaccccacttattcacctttaaagtgaatttc |
32344736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 111 - 220
Target Start/End: Complemental strand, 34884243 - 34884133
Alignment:
| Q |
111 |
ctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||| |||| || ||| ||| |||| |||| ||||||||| ||||||||||||||| |||||| | ||||||| ||||| ||||||| ||| |
|
|
| T |
34884243 |
ctcatttggtaaaggatgatagatattatatgcaagggttggggttcgacccccggacaccccacatattcaccattaaggtaaatttatctagccgcta |
34884144 |
T |
 |
| Q |
210 |
ggctacttgac |
220 |
Q |
| |
|
| ||||||||| |
|
|
| T |
34884143 |
gactacttgac |
34884133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 14981758 - 14981680
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| || || ||||||| ||||||||||||||||| |||| |
|
|
| T |
14981758 |
tgcaggggccggggttcgaaccctggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgac |
14981680 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 29284160 - 29284230
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||| |
|
|
| T |
29284160 |
agggatcggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctac |
29284230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 32611623 - 32611546
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
32611623 |
ccatgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
32611546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 111 - 214
Target Start/End: Original strand, 9357165 - 9357269
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||| ||||| |||||| | ||| |||||||||| ||||||||||| || |||||| | ||||||| |||||||||||||||||||| ||||| |
|
|
| T |
9357165 |
ctcatttgataagggataatgtacaatttgtgcaggggctggggttcgaactccagacacctaatttattcacctttaaggtgaatttctctaatcacta |
9357264 |
T |
 |
| Q |
210 |
ggcta |
214 |
Q |
| |
|
||||| |
|
|
| T |
9357265 |
ggcta |
9357269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 12089136 - 12089215
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
12089136 |
tgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggatacctgacc |
12089215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 180
Target Start/End: Original strand, 30833056 - 30833096
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30833056 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
30833096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 207
Target Start/End: Complemental strand, 1184023 - 1183941
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc-acttattcatctttaaggtgaatttctctagccac |
207 |
Q |
| |
|
||||| |||||||| |||||||| ||||||| || || ||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
1184023 |
ataatccataatatatgcaggggcaggggttccaatcc-ggacacccccacttattcacctttaaggtgaatttctctagccac |
1183941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 6530260 - 6530182
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||||||| ||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
6530260 |
tgcaggggccggggttcaaacctcggacaccccacttattcaccttataaggtgaat---tctagccactagactacttgac |
6530182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 17398072 - 17398119
Alignment:
| Q |
19 |
acatcagtagtgtcacccttgatatcggtgttgtcgcaggctcagaaa |
66 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
17398072 |
acatcagtagtgtcacccttgatattggtgttgtcgcaggctcggaaa |
17398119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 93 - 176
Target Start/End: Complemental strand, 19953903 - 19953820
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
19953903 |
caatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
19953820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 220
Target Start/End: Complemental strand, 31703803 - 31703704
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||| ||| | | ||||| | |||||||||||| ||||| |||||||||| |||||| ||||||||| ||||| ||||| |||||||| |
|
|
| T |
31703803 |
aaggataatgcatattatatactggggttgaggttcgaacccctaacacctcacttattcacttttaagatgaatttctttagccgctaggttacttgac |
31703704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 125 - 203
Target Start/End: Original strand, 32470708 - 32470787
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc-acttattcatctttaaggtgaatttctctag |
203 |
Q |
| |
|
|||||||||||||| |||||||| | |||| ||||| | |||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
32470708 |
ataatgcataatatatgcaggggctgaggtttgaacctcagacacccctacttattcacctttaaggtgaatttctctag |
32470787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 200
Target Start/End: Original strand, 34368182 - 34368260
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||||||||| ||| ||||||||| | ||||||||||||||| || ||||||||| | ||||||| |||||||||| |
|
|
| T |
34368182 |
aaggataatgcata-tatatgcaggggttgaggttcgaaccccggatacaccacttatttacctttaagatgaatttctc |
34368260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 114 - 220
Target Start/End: Complemental strand, 35065572 - 35065466
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
||||||||||| |||||||||||| | || ||||| |||| |||||||| ||||||| | ||||||||| ||||| |||||||||||||||| ||| || |
|
|
| T |
35065572 |
atttggtaagggataatgcataatttatgtaggggccggg-ttcgaaccacggacactctacttattcacatttaaagtgaatttctctagccgctaagc |
35065474 |
T |
 |
| Q |
213 |
tacttgac |
220 |
Q |
| |
|
| |||||| |
|
|
| T |
35065473 |
tgcttgac |
35065466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 978200 - 978126
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| || ||| ||||| |||||| ||| ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
978200 |
tgagtttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacaccggacaccccactt |
978126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 172
Target Start/End: Original strand, 1969000 - 1969070
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
1969000 |
tgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacacccc |
1969070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 7545333 - 7545407
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| | |||||||||||||| ||||||||||| |
|
|
| T |
7545333 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccccgaacaccccactt |
7545407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 197
Target Start/End: Complemental strand, 7563632 - 7563574
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
|||||||||| |||||| |||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
7563632 |
tgcaggggtcagggttcaaaccccggacaccccacttattcaccttataaggtgaattt |
7563574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 8297631 - 8297705
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| ||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8297631 |
tgagcttagctcaattggtagggatgttgcatgttatatgcaggggccggggttcgaaccccggacaccccactt |
8297705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 9064905 - 9064984
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||| | || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
9064905 |
tgcaggggccggggttcgaaccccagacaccccacttatttactttaaaagtgaatt--tctagccactaggctacctgacc |
9064984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 9435630 - 9435704
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
9435630 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccactt |
9435704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 143 - 205
Target Start/End: Original strand, 9455881 - 9455943
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
||||||||| ||||||||||| |||||||||||||||| ||||||| ||||||| ||||||| |
|
|
| T |
9455881 |
aggggtcggagttcgaaccccaaacaccccacttattcacctttaagttgaatttttctagcc |
9455943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 10483598 - 10483528
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| ||||| ||| |||||||||||||||||||||||||||||| |||||| |
|
|
| T |
10483598 |
cttagctcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccggacactccactt |
10483528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 10934603 - 10934677
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
10934603 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
10934677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17441905 - 17441831
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
17441905 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
17441831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19892342 - 19892268
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| || ||||||||||||||||||||||||||| |||||| |
|
|
| T |
19892342 |
tgagcttagttcagttggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacactccactt |
19892268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 22997340 - 22997414
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
22997340 |
tgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctactt |
22997414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 23791061 - 23790987
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| || ||||||||||||||||||||||||||||| |||| |
|
|
| T |
23791061 |
tgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctactt |
23790987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 180
Target Start/End: Original strand, 30938392 - 30938470
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||||| ||||||| ||||||||||||||| ||||||| |||||||| |
|
|
| T |
30938392 |
tgagcttaactcagttggtagggacattgcataatatatgcagggaccggggttcgaaccccagacaccctacttattc |
30938470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 31802057 - 31802131
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
31802057 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
31802131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 35190802 - 35190875
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||| |||||||||||| |||||||||||||||| ||| |||||||||| |||||||||||| |||| |
|
|
| T |
35190802 |
tgcaggggtcggagttcgaaccccgaacaccccacttattcaccttataaggtgaat---tctagccactagactac |
35190875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 120 - 169
Target Start/End: Complemental strand, 16913948 - 16913899
Alignment:
| Q |
120 |
taaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
16913948 |
taaggatattgcatattatatgcaggggtcggggttcgaaccccggacac |
16913899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 18904294 - 18904343
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
18904294 |
aatgcattttatatgcaggggtcggggttcgaaccccggacaccccactt |
18904343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 22389806 - 22389749
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||| ||||||||| ||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
22389806 |
tgcaggggtcagggttcgaatcccggacaccccacttattcaccttataaggtgaatt |
22389749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 150 - 214
Target Start/End: Complemental strand, 33628987 - 33628925
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || || ||||||| |||||||||||||||| |
|
|
| T |
33628987 |
ggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggcta |
33628925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 153 - 221
Target Start/End: Complemental strand, 3338350 - 3338282
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| ||||||| ||||||||| |||||||||||||||| ||| | |||||||| |||||| |
|
|
| T |
3338350 |
gttcgaaccccagacaccctacttattcacatttaaggtgaatttctatagtcgctaggctatttgacc |
3338282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 196
Target Start/End: Complemental strand, 6025461 - 6025386
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| || || ||||||||||||| ||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
6025461 |
aggataatgcattattatatgcaggggtcgggattcgaaccccggaca-tccacttattcatcttataaggtgaatt |
6025386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6196589 - 6196533
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||| || |||||||||||||||||| |
|
|
| T |
6196589 |
agcttaactcagttggtaaggacaatgcataatatatgtaggggtcggggttcgaac |
6196533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 182
Target Start/End: Complemental strand, 21874319 - 21874235
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||| |||||||||| ||| || ||||||| |||| ||||| ||||||||||| |
|
|
| T |
21874319 |
ccataagcttaactcatttggtaagggataatgcacaatatgtgcatgggcaggagttcgaatcccgaacacctcacttattcat |
21874235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 94 - 181
Target Start/End: Original strand, 7153784 - 7153871
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| ||||||||||| |||| |||||| ||||| ||||| ||| |||||||| || |||||||| ||||||||| |||||| |||| |
|
|
| T |
7153784 |
aatctccatgagcttaactcagttggtagggatattgcatgttatatgcaggggccgaggttcgaatcccggacactccacttcttca |
7153871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 7207848 - 7207915
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
7207848 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacac |
7207915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 12127965 - 12127887
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||| ||||||||||| ||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
12127965 |
tgcaggggtcggaattcgaaccccggacacgccacttattcaccttataaggtgaat---tctagccactagactacctgac |
12127887 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 149 - 221
Target Start/End: Complemental strand, 18904730 - 18904660
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| | |||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18904730 |
cggggttcgaactctggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
18904660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 23610385 - 23610306
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | ||||||||||||||||| ||| | ||||||||||||| |||| |
|
|
| T |
23610385 |
tgagcttagctcagttggtagggacattgcataatttatgcaggggtcggggttcaaacgctggacaccccacttcttca |
23610306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 169
Target Start/End: Original strand, 24466829 - 24466899
Alignment:
| Q |
99 |
ccatgagcttatctcatttggt-aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| |||||| |||||||||| |||||||||||||| ||| |||||||| |||||||||||||| |||||| |
|
|
| T |
24466829 |
ccataagcttagctcatttggtgaaggataatgcata-tatatgcaggggacggggttcgaaccctggacac |
24466899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 125 - 203
Target Start/End: Original strand, 32502211 - 32502290
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc-cacttattcatctttaaggtgaatttctctag |
203 |
Q |
| |
|
|||||||||||||| |||||||| || |||| ||||| | ||||||| ||||||| | ||||||||||||||||||||| |
|
|
| T |
32502211 |
ataatgcataatatatgcaggggccgaggtttgaacctcagacacccttacttattaacctttaaggtgaatttctctag |
32502290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 32813716 - 32813637
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||| || |||||| |||| |
|
|
| T |
32813716 |
tgagcttagttcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggatactccacttcttca |
32813637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 743567 - 743641
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| || |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
743567 |
tgagcttagctcagttggtagggatattgcatattagatgcaggagccggggttcgaaccccggacactccactt |
743641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 788867 - 788929
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| |||| || |||| |||| ||||||| |
|
|
| T |
788867 |
tgagcttatctcagttggtaaggacaatgcataatatatgcaaggttcggagttcaaaccccg |
788929 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 116 - 174
Target Start/End: Complemental strand, 894684 - 894626
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||||| ||||| |||||| ||| ||||||||||| |||||||||||||||||| |||| |
|
|
| T |
894684 |
ttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccggacactccac |
894626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3640518 - 3640592
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||| ||| ||||||||||||| ||||||| |||||| |
|
|
| T |
3640518 |
tgagcttagctcagttggtagggatattgcatagtatatgcaagggccggggttcgaacctcggacactccactt |
3640592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 3794239 - 3794165
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
3794239 |
tgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
3794165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 7418282 - 7418356
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||| ||||| |||||| ||| |||||||| | | |||||||||| |||||| |||||| |
|
|
| T |
7418282 |
tgagcttaactcatttggtagggatattgcatattatatgcaggggcctgagttcgaaccctggacactccactt |
7418356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 9246448 - 9246374
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
9246448 |
tgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
9246374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 181
Target Start/End: Complemental strand, 9491788 - 9491750
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9491788 |
aggggccggggttcgaaccccggacaccccacttattca |
9491750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 16251579 - 16251506
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||||| ||| |||||||||| ||||| ||||||||||| |
|
|
| T |
16251579 |
tgcaggggtcgttgttcgaactccggacaccccacttattcaccttataaggtgaat---tctagtcactaggctac |
16251506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 26528606 - 26528664
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
26528606 |
tgcaggggtcggggttcaaacctcggacaccccacttattcaccttataaggtaaattt |
26528664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 28030868 - 28030942
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| | |||||||||||| |||||| |||||| |
|
|
| T |
28030868 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccctggacactccactt |
28030942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 29284270 - 29284344
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| || ||||| ||| |||||||||||||||||||||||| |
|
|
| T |
29284270 |
tgagtttagctcagttggtagggatattgcatattatatgaaggggccggagttcgaaccccggacaccccactt |
29284344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 30704964 - 30705038
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| ||||| ||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
30704964 |
tgagcttagttcagttggtagggatattgcatgttatatgtaggggccggggttcgaaccccggacaccccactt |
30705038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 32166373 - 32166447
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||| || ||||||||||||| |||||| |
|
|
| T |
32166373 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggccgggatttgaaccccggacactccactt |
32166447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 33573821 - 33573895
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||| |||||| |||||| |
|
|
| T |
33573821 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccactt |
33573895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 180
Target Start/End: Complemental strand, 753365 - 753328
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
753365 |
aggggtcggggttcgaaccctggacaccccacttattc |
753328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 11636702 - 11636743
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
11636702 |
tgcaggggtcggagttcgaaccccggacaccccactttttca |
11636743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 12101925 - 12101982
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
12101925 |
tgcaggggccggcgttcgaaccccggacaccctacttattcaccttataaggtgaatt |
12101982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 172
Target Start/End: Complemental strand, 13116689 - 13116620
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
||||||| |||| |||||||||||| |||| ||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
13116689 |
gagcttagctcagttggtaaggatatcacatattatatgcaagggccggggttcgaaccccggacacccc |
13116620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 15289001 - 15288933
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| || ||||||||||||||||||||| |||||||||| |||||||||| |||||||||| |
|
|
| T |
15289001 |
ggggttcgaactccagacaccccacttattcatcttataaggtgaat---tctagccactgtgctacttgac |
15288933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 19417861 - 19417918
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||| ||||| |||||| ||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
19417861 |
tgcagggatcgggattcgaatcccagacaccccacttattcatcttataaggtgaatt |
19417918 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 27667189 - 27667238
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27667189 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
27667238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 33646852 - 33646913
Alignment:
| Q |
116 |
ttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| | || |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
33646852 |
ttggtagggatattgcatatttatatgcaggggtcggggttcgaacctcggacaccccactt |
33646913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 136 - 185
Target Start/End: Original strand, 34365770 - 34365819
Alignment:
| Q |
136 |
tatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| ||||||||||||| || |||| ||||||||||||||| |
|
|
| T |
34365770 |
tatgtgcaggggccggggttcgaacctcgaacactccacttattcatctt |
34365819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 178
Target Start/End: Original strand, 389338 - 389413
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||| |||||| ||||| | ||| ||| |||||||||||| ||||||||||||||||| |||||||| |
|
|
| T |
389338 |
tgagcttaactcagttggtatggatatttcatt-tatatgcaggggtcggagttcgaaccccggacactccacttat |
389413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 2488952 - 2488872
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||| ||| |||| |||||| ||| | || ||||| | |||||||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
2488952 |
tgagtttagctcagttggtagggacattgtataatttctgcaggggtcggagttcgaaccccggacatcccacttcttcat |
2488872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 152 - 221
Target Start/End: Complemental strand, 5134478 - 5134411
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| | ||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
5134478 |
ggttcgaacctcagacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
5134411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 180
Target Start/End: Original strand, 5544315 - 5544355
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
5544315 |
tgcaggggtcggggttcgaaccccagataccccacttattc |
5544355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 105 - 169
Target Start/End: Original strand, 7072085 - 7072149
Alignment:
| Q |
105 |
gcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||| |||| |||||| ||||| | |||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
7072085 |
gcttaactcagttggtagggatattacatattatatgcaggagtcggggttcgaaccccggacac |
7072149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 121 - 205
Target Start/End: Complemental strand, 8330566 - 8330482
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
||||||||| |||| ||| || |||| ||| ||||||| || |||| ||||||||||| ||||||||||||||||||||||| |
|
|
| T |
8330566 |
aaggataatacatattatatgtagggaccggagttcgaagccaaaacactccacttattcacctttaaggtgaatttctctagcc |
8330482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 10913123 - 10913071
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
10913123 |
gatattgcatattatatgcaggggtcggggttcgaaccccagacactccactt |
10913071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 13656269 - 13656349
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||| || |||||||||| ||||||||||| ||| ||||||| |||||||||||| |||| |
|
|
| T |
13656269 |
tgagcttagctcagttggtagggacaaatgcataatatatgcaggggtcgatgtttgaaccccagacaccccacttcttca |
13656349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 180
Target Start/End: Complemental strand, 19680304 - 19680264
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
19680304 |
tgcaggagccggggttcgaaccccggacaccccacttattc |
19680264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 24319031 - 24319091
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||| | |||||||| | |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
24319031 |
ttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacactccactt |
24319091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 166
Target Start/End: Original strand, 24758743 - 24758807
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
24758743 |
tgagcttaactcaattggtagggatatcgcattttatatgcaggggtcggggttcgaaccccgga |
24758807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 31952311 - 31952347
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
31952311 |
tgcaggggttggggttcgaaccccggacaccccactt |
31952347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 165 - 204
Target Start/End: Complemental strand, 1194734 - 1194696
Alignment:
| Q |
165 |
gacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
1194734 |
gacaccccacttattca-ctttaaggtgaatttctctagc |
1194696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 179
Target Start/End: Original strand, 2945635 - 2945674
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
||||||||||||||||| |||| ||||||||||||||||| |
|
|
| T |
2945635 |
tgcaggggtcggggttcaaacctcggacaccccacttatt |
2945674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 92 - 175
Target Start/End: Complemental strand, 5052149 - 5052066
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||| || |||||||| |||| |||||| ||||| |||| ||| |||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
5052149 |
tcaatccccgtgagcttagctcaattggtagggatatcgcattttatatgcaggagtcggggtttgaaccccggacactccact |
5052066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 8439679 - 8439746
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||| |||||| || |||||| |
|
|
| T |
8439679 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaatcctggacac |
8439746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 171
Target Start/End: Original strand, 10373634 - 10373665
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10373634 |
tgcaggggtcggggttcgaaccccggacaccc |
10373665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 19165390 - 19165467
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||| |||||||||||||| ||||||||||||||||| ||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
19165390 |
tgcagaggttggggttcgaacccc-gacaccccacttattcaccttataaggtgaat---tctagccactagtctacctgac |
19165467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 146 - 181
Target Start/End: Complemental strand, 19642597 - 19642562
Alignment:
| Q |
146 |
ggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||| |
|
|
| T |
19642597 |
ggtcggggttcgaaccccagacaccccacttattca |
19642562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 183
Target Start/End: Complemental strand, 25064725 - 25064682
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatc |
183 |
Q |
| |
|
||||||||| |||||||||||||| |||||||||||| |||||| |
|
|
| T |
25064725 |
tgcaggggttggggttcgaaccccagacaccccacttcttcatc |
25064682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 32283542 - 32283609
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | |||| ||||||||||||||||||| ||||| |
|
|
| T |
32283542 |
tgagcttagctcaattggtagggacattgcataatttatgcaagggtcggggttcgaaccccagacac |
32283609 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 34268286 - 34268365
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| |||||| ||| | |||||||| | |||||||||| |||||||||||||| |||||| |||| |||| |
|
|
| T |
34268286 |
tgagcttagctccgttggtagggacattgcataatttatgcaggggtcagggttcgaaccccgaacaccctacttcttca |
34268365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 216210 - 216284
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
216210 |
tgagcttagctcaattggtagggatattgcatgttatatgcagggtctggggttcgaacctcggacaccccactt |
216284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 361167 - 361241
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | || ||||||||| || |||||||||||| |
|
|
| T |
361167 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagccgaggttcgaactccagacaccccactt |
361241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 185
Target Start/End: Complemental strand, 2416014 - 2415973
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
2416014 |
aggggtcggagttcgaaccccg-acaccccacttattcatctt |
2415973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 174
Target Start/End: Original strand, 4408352 - 4408434
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||| | ||||| |||| |
|
|
| T |
4408352 |
tcaatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccacagacactccac |
4408434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 4869764 - 4869706
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||| |
|
|
| T |
4869764 |
tgagcttagctcagttggtagggatactgcatattatatgcaggggccggggttcgaac |
4869706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 181
Target Start/End: Original strand, 6144014 - 6144044
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
6144014 |
gggttcgaaccccggacaccccacttattca |
6144044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 6210062 - 6210132
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
6210062 |
cttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
6210132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #147
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 6270665 - 6270596
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactagg |
211 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||| ||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
6270665 |
tgcaggggccggggttcgaaccctgaacaccccaattattcaccttataaggtgaat---tctagccactagg |
6270596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #148
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 7177299 - 7177373
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || || ||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
7177299 |
tgagcttagctcagttggtagggatattgtattttatatgcaggggctggggttcgaaccccagacaccccactt |
7177373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #149
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 93 - 163
Target Start/End: Original strand, 8857085 - 8857155
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| | |||| ||| |||||||| ||||||||||||||| |
|
|
| T |
8857085 |
caatccccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaacccc |
8857155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #150
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 12284125 - 12284199
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| |||||| |||||||||||||| ||||| || |||||| |
|
|
| T |
12284125 |
tgagcttaactcagttggtagggatattgaatattatatgcaggtgtcggggttcgaactccggaaactccactt |
12284199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #151
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 15964009 - 15963935
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| | | |||||||| ||||||||||||| |||||| |||||| |
|
|
| T |
15964009 |
tgagcttagctcagttggtagggatattgcatattttatgcaggggctggggttcgaaccctggacactccactt |
15963935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #152
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19374906 - 19374832
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| || ||| | ||| |||||| ||| ||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
19374906 |
tgagcttagctcagttagtaggaatattgcatattatatgcaggggttggggttcgaaccccgaacactccactt |
19374832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #153
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 22574874 - 22574948
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| ||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
22574874 |
tgagcttagctcagttggtagggatatcgcattttatatgcaggggttggggttcgaaccccgcacactccactt |
22574948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #154
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 28148795 - 28148725
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||| | |||| |||||||||||||||| |||||| |
|
|
| T |
28148795 |
cttagctcagttggtagggatattgcatattatatgcaggagccgggtttcgaaccccggacactccactt |
28148725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #155
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 150 - 188
Target Start/End: Complemental strand, 29430349 - 29430311
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
29430349 |
ggggttcgaacctcggacaccccacttattcacctttaa |
29430311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 32670120 - 32670046
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| | ||| |||||||| | |||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
32670120 |
tgagcttagctcaattggtaggaatattgcataatttatgcaggggcaggggttcgaacccctgacaccctactt |
32670046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 33697179 - 33697105
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| ||||| ||| |||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
33697179 |
tgagcttaactcagttgatagggatattgcattttatatgcaggggtcggagttcgaatcccggacactccactt |
33697105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 34432863 - 34432789
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| ||||| ||| |||||||||||||| ||||| |||||| |
|
|
| T |
34432863 |
tgagcttagttcagttggtagggatattgcatattatatgcagaggttggggttcgaaccccagacactccactt |
34432789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #159
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 2816891 - 2816968
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| ||||| ||| |||||||| | | ||||||| ||||||||||||||| |
|
|
| T |
2816891 |
ccatgagcttagctcaattggtagggatattgcatgttatatgcaggggctgagattcgaactccggacaccccactt |
2816968 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #160
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 5288401 - 5288344
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||| ||||| ||||||||| || ||||||| ||| ||||||||||| |
|
|
| T |
5288401 |
tgcaggggtcggggtccgaactccggacacctcaattattcaccttataaggtgaatt |
5288344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #161
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 153 - 215
Target Start/End: Complemental strand, 7720546 - 7720486
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||| ||| ||||||| || ||||||| ||||||||| |
|
|
| T |
7720546 |
gttcgaaccccggacaccccacttattcaccttataaggtggat---tctagccgctaggctac |
7720486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #162
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 8185806 - 8185859
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtga |
193 |
Q |
| |
|
||||||||| ||||||||||| ||| |||| ||||||||| ||||| ||||||| |
|
|
| T |
8185806 |
tgcaggggtaggggttcgaactccgaacactccacttatttatcttaaaggtga |
8185859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #163
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 9981534 - 9981583
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||| ||||| ||| |||||||||||| ||||||||||||| |
|
|
| T |
9981534 |
aatgcataatatatgcagaggttggggttcgaacctaggacaccccactt |
9981583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #164
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 10377180 - 10377139
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| || |||||||||||||||| |||||||||||||||| |
|
|
| T |
10377180 |
tgcagaggccggggttcgaaccccgaacaccccacttattca |
10377139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #165
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 180
Target Start/End: Original strand, 10455781 - 10455822
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggaca-ccccacttattc |
180 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||||||||||| |
|
|
| T |
10455781 |
tgcaggggccggggttcgaaccccggacacccccacttattc |
10455822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #166
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 11982801 - 11982857
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||| || ||||| ||||||||||| |
|
|
| T |
11982801 |
tgcaggggtcgggttt-gaaccccggacaccccacttgtttatcttataaggtgaatt |
11982857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #167
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 181
Target Start/End: Complemental strand, 17751381 - 17751352
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
17751381 |
ggttcgaaccccggacaccccacttattca |
17751352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #168
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 18244068 - 18244012
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| |||||||||||||| |||||| |||| ||||||||||||| ||||||||||| |
|
|
| T |
18244068 |
tgcagaggtcggggttcgaa-cccggataccctacttattcatcttataaggtgaatt |
18244012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #169
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 19279488 - 19279529
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
19279488 |
tgcaggggccggagttcgaacctcggacaccccacttattca |
19279529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #170
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19618794 - 19618718
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcata--atatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| |||| | |||||| ||||||||||||||||||||||||||| |
|
|
| T |
19618794 |
tgagtttagctcaattggtagggatattgcatattatatatacaggggctggggttcgaaccccggacaccccactt |
19618718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #171
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 21507257 - 21507216
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| ||| |||| |||||||||||||||||||| |
|
|
| T |
21507257 |
tgcaggggtcggagtttgaactccggacaccccacttattca |
21507216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #172
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 23771072 - 23771129
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca-tctttaaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
23771072 |
tgcaggggaaggggttcgaactccggacaccccatttattcactctataaggtgaatt |
23771129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #173
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 24256955 - 24256996
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| || ||||||||||||||| |||||||||||||| |
|
|
| T |
24256955 |
tgcaggggccgaggttcgaaccccggataccccacttattca |
24256996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #174
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 32057073 - 32057130
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||||| |||||||||||| || | |||||||||||||||| ||||||||||| |
|
|
| T |
32057073 |
tgcagtggtcgaggttcgaaccccagagatcccacttattcatcttataaggtgaatt |
32057130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #175
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 34524914 - 34524955
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||||||||||| |
|
|
| T |
34524914 |
tgcaggggccggggttcgagccccgaacaccccacttattca |
34524955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #176
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 173
Target Start/End: Complemental strand, 35038730 - 35038697
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| |
|
|
| T |
35038730 |
tgcaggggccggggttcgaaccccggacacccca |
35038697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 181
Target Start/End: Complemental strand, 30345 - 30293
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||| |||||| |||||| |||| |
|
|
| T |
30345 |
tgcatattatatgcaggggccggggttcgaaccctggacactccacttcttca |
30293 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 2726473 - 2726409
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| |||||| ||| |||||||||||| |||| || ||||||||||||||||| |||| |
|
|
| T |
2726473 |
cttaactcagttggtatggacaatgcataatatatgcaaggtccggggttcgaaccccggtcacc |
2726409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6196413 - 6196357
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||||| |||| | |||||||| |||||||||||| || ||||||| |||||||||| |
|
|
| T |
6196413 |
agcttaactcagtcggtaaggacaatgcataatatatgtaggggtccgggttcgaac |
6196357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6196501 - 6196445
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||||| |||| | |||||||| ||| |||||||| || |||||||||||||||||| |
|
|
| T |
6196501 |
agcttaactcagtcggtaaggacaatacataatatatgtaggggtcggggttcgaac |
6196445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 158 - 221
Target Start/End: Original strand, 11636743 - 11636804
Alignment:
| Q |
158 |
aaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||| ||||| || || ||||||| |||| |||||||||||| ||||| |
|
|
| T |
11636743 |
aaccccggacaccccactttttcattttaaaagtgaatt--tctaaccactaggctacctgacc |
11636804 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 13158761 - 13158701
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| ||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
13158761 |
ttggtagggatattgcatattatatgcagagactggggttcgaaccccggacaccccactt |
13158701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #183
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 13163617 - 13163557
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| ||| ||||| | ||||||||||||||||||||||||||| |
|
|
| T |
13163617 |
ttggtagggatattgcatattatatgcagagactggggttcgaaccccggacaccccactt |
13163557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #184
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 220
Target Start/End: Complemental strand, 18991471 - 18991420
Alignment:
| Q |
166 |
acaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||| | ||||||||||| ||||||||||||||||||||| |
|
|
| T |
18991471 |
acaccccacttattcacttataaggtgaatt---ctagccactaggctacttgac |
18991420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #185
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 21047743 - 21047809
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| ||||| |||||||||||||||||| ||| |||| |||| ||||| |||||||||||||| |
|
|
| T |
21047743 |
tgagcttaactcatctggtaaggataatgcatagtatatgca-aggtc-gggtttgaaccccggacacc |
21047809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #186
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 30566114 - 30566154
Alignment:
| Q |
157 |
gaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
30566114 |
gaaccccggacaccccacttattcaccttataaggtgaatt |
30566154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #187
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 32788882 - 32788846
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
32788882 |
tgcaggggttggggttcgaactccggacaccccactt |
32788846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 103; Significance: 2e-51; HSPs: 315)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 103; E-Value: 2e-51
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 16556448 - 16556570
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
16556448 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggtcggggttcgaaccccgaacaccccacttattcatctttaaggtgaattt |
16556547 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
16556548 |
ctctagccactaggctacttgac |
16556570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 93; E-Value: 2e-45
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 40407059 - 40406935
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcgggg-ttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40407059 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccgggggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
40406960 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||| ||||||| |
|
|
| T |
40406959 |
tctctagccactaggctgcttgacc |
40406935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 45848024 - 45847901
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45848024 |
ccatgaacttatctcatttgataagggataatgcataatatgtgcagggatcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
45847925 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|| ||||| ||||||| ||||||| |
|
|
| T |
45847924 |
ctttagcccctaggctgcttgacc |
45847901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 46283119 - 46283242
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46283119 |
ccatgagcttacctcatttggtaagggataatgcacaatatgtgcagcggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
46283218 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| |||||| |||||||||| |
|
|
| T |
46283219 |
ctctagtcactagactacttgacc |
46283242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 103 - 221
Target Start/End: Complemental strand, 11491313 - 11491194
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11491313 |
gagcttagctcatttgacaagggataatgcataatttgtgcaggggccggagttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
11491214 |
T |
 |
| Q |
202 |
agccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||| |
|
|
| T |
11491213 |
agccactaggctacttgacc |
11491194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 50815704 - 50815827
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| ||| |||||||||| ||| |||||||||| |||||||||||||||||||||||||| |||||||||| ||||||||||| |
|
|
| T |
50815704 |
ccatgagcttagctcatttgataaaggataatgcacaatttgtgcaggggccggggttcgaaccccggacaccccacatattcatcttaaaggtgaattt |
50815803 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
50815804 |
ctctagccactaggctacttgacc |
50815827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 51974744 - 51974867
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||||||||| |||||||| |||||| |||||||||| ||||||||||||||||| |
|
|
| T |
51974744 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggtcgggattcgaacctcggacatcccacttatttatctttaaggtgaattt |
51974843 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
51974844 |
atctagccactaggctacttgacc |
51974867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 48404235 - 48404113
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||| |||||||||| ||| |||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
48404235 |
ccatgagcttagctcatttgataagagataatgtataatatgtgtaggtgtcggggttcgaaccccggacacctcacttattcatctttaaggtgaattt |
48404136 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|| |||||||||||||||||||| |
|
|
| T |
48404135 |
ctttagccactaggctacttgac |
48404113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 93 - 217
Target Start/End: Original strand, 38690657 - 38690782
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||| ||||||||||| |||| ||||||||| |||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38690657 |
caatccccatgagcttagctcacttggtaagggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttattctcctttaaggt |
38690756 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||||| ||||||||||| |
|
|
| T |
38690757 |
gaatttctctagccgctaggctactt |
38690782 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 45355817 - 45355694
Alignment:
| Q |
99 |
ccatgagctta--tctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaat |
195 |
Q |
| |
|
||||||||||| |||||||| |||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45355817 |
ccatgagcttagctctcatttagtaagggataatgcacaatatgtgtaggggtcggggttcgaaccccggacaccc-acttattcatctttaaggtgaat |
45355719 |
T |
 |
| Q |
196 |
ttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45355718 |
ttctctagccactaggctacttgac |
45355694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 45369558 - 45369435
Alignment:
| Q |
99 |
ccatgagctta--tctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaat |
195 |
Q |
| |
|
||||||||||| |||||||| |||||| |||||||| |||||||| ||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
45369558 |
ccatgagcttagctctcatttagtaagggataatgcacaatatgtgtaggggtcggggttcgaaccccggacaccc-acttattcatctttaaggtgaat |
45369460 |
T |
 |
| Q |
196 |
ttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
45369459 |
ttctctagccactaggctacttgac |
45369435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 36993038 - 36993160
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| |||||||| |||||| |||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
36993038 |
ccatgagcttagctcatttgataagggataatgcacaatatgtgaaggggttggggtttgaaccccggacaccccaattattcatctttaaggtgaattt |
36993137 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
36993138 |
ctctagccactaggctacctgac |
36993160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 2832169 - 2832048
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||| |||||||| | ||||| |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
2832169 |
ccatgagcttagctcatctggtaaggggtgatgcacaatatgtgcaggggtcggggttcgaaccccaaacaccccacttattcatctttaaggtgaattc |
2832070 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
2832069 |
ctctagccactaggttacttga |
2832048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 37574270 - 37574392
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| | | |||||||| |||||||| |||||||| ||||||||||||||| ||||||||||||||| |
|
|
| T |
37574270 |
ccatgagcttagctcatttggtaagggataatgcatt-tgtatgcaggggccggggttcaaaccccgggcaccccacttattcacctttaaggtgaattt |
37574368 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
37574369 |
ctctagccactaggctacttgacc |
37574392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 37889704 - 37889583
Alignment:
| Q |
99 |
ccatgagcttatctcatttggt-aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||| || || ||||| |||| ||| ||| ||||||||||||||||||||||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
37889704 |
ccatgagcttagctcacttcgttaaggacaatgtatattatatgcaggggtcggggttcgaaccccggacacctcacttattcacttttaaggtgaattt |
37889605 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
37889604 |
ctctagccactaggctacttga |
37889583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 42154564 - 42154685
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| || ||||||||||| ||||| || ||||||||||| |||||||||||||||||||||||| |||||| |||||||||||||||||||| |
|
|
| T |
42154564 |
catgagcttaacttatttggtaagggataattcacaatatgtgcagaggtcggggttcgaaccccggacacttcacttaatcatctttaaggtgaatttc |
42154663 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| || ||||||||||| |
|
|
| T |
42154664 |
tctagccgctgggctacttgac |
42154685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 99 - 199
Target Start/End: Complemental strand, 43362266 - 43362165
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| ||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43362266 |
ccatgagcttagctcatttgctaagggataatgcacaatatattcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
43362167 |
T |
 |
| Q |
198 |
ct |
199 |
Q |
| |
|
|| |
|
|
| T |
43362166 |
ct |
43362165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 26885498 - 26885376
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||| | || |||||||| | ||| ||| |||| ||||||||||||||||||||| ||||||||| |||||||||||| |||| |
|
|
| T |
26885498 |
ccatgagcttagctcatttggcaggggataatgcacattatatgctggggccggggttcgaaccccggacactccacttatttatctttaaggtggattt |
26885399 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
26885398 |
ctctagccactaggctacttgac |
26885376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 99 - 206
Target Start/End: Original strand, 43084444 - 43084552
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| ||||| | ||||||||||||||||| || || |||||||||||||||||||||||||||||| |
|
|
| T |
43084444 |
ccatgagcttaactcatttggtaaggaataatgcacaatatatataggggtcggggttcgaatcctggttaccccacttattcatctttaaggtgaattt |
43084543 |
T |
 |
| Q |
198 |
ctctagcca |
206 |
Q |
| |
|
||||||||| |
|
|
| T |
43084544 |
ctctagcca |
43084552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 112 - 201
Target Start/End: Complemental strand, 22096476 - 22096386
Alignment:
| Q |
112 |
tcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||| || ||||||||| ||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
22096476 |
tcatttggtaagggataatgcacaatatgtgcaggggccgaggttcgaactccggacaccccacttattcatttttaaggtgaatttctct |
22096386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 111 - 219
Target Start/End: Complemental strand, 25234944 - 25234835
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||| ||||| |||||||| |||| ||| |||||| | |||||||||||| ||||||||| |||||||||||||||||||||||||||| |||||| |
|
|
| T |
25234944 |
ctcatttgataagggataatgcacaataagtgtaggggttgaggttcgaaccccagacaccccagttattcatctttaaggtgaatttctctaaccacta |
25234845 |
T |
 |
| Q |
210 |
ggctacttga |
219 |
Q |
| |
|
| |||||||| |
|
|
| T |
25234844 |
gactacttga |
25234835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 100 - 219
Target Start/End: Original strand, 29430495 - 29430615
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| || | ||||||||| | |||||||| ||| ||||| | |||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
29430495 |
catgagcttagcttacttggtaagggacaatgcatattatatgcagtgatcggggttcgaaccccggacaccctacttattcatctttaaggtgaattta |
29430594 |
T |
 |
| Q |
199 |
tctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| || |||||||| |
|
|
| T |
29430595 |
tctagccaataaactacttga |
29430615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 44251383 - 44251303
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||| ||||||||||||||||||||||| ||||||| |||||||| ||||| |
|
|
| T |
44251383 |
tgcaggggtcggggttcgaatcccggacaccccatttattcatctttaaggtgaatttttctagccgctaggctatttgac |
44251303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 35909127 - 35909005
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcgg-ggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
||||||||||| ||||||| |||||| |||||||| ||||| |||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
35909127 |
ccatgagcttagctcattttgtaagggataatgcacaatatatgcaggggtcggaggttcgaatcccagacaccccacttatttatctttaaggtgaatt |
35909028 |
T |
 |
| Q |
197 |
tctctagccactaggctacttga |
219 |
Q |
| |
|
| || | |||||| | ||||||| |
|
|
| T |
35909027 |
tttccaaccactaagttacttga |
35909005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 56555571 - 56555668
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| ||| |||||||||||||||||||||| || |||||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
56555571 |
ggataatgcatt-tatatgcaggggtcggggttcgaacctcgaacaccccacttattcacctttaaggtgaatttctctagccgttaggctacctgacc |
56555668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 101 - 209
Target Start/End: Complemental strand, 13210260 - 13210146
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggtga |
193 |
Q |
| |
|
||||||||| |||||||||| ||| |||||||| |||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
13210260 |
atgagcttagctcatttggtcagggataatgcacaatatgtgcaggggccggggttcgaaccccgggtacggacacctcacttattcat-tttaaggtga |
13210162 |
T |
 |
| Q |
194 |
atttctctagccacta |
209 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
13210161 |
atttctctagccacta |
13210146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 197
Target Start/End: Original strand, 23448970 - 23449068
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| || ||||||||||| |||||||| ||||||||||||||| ||||||||||||||| ||||||||||||||||| ||||||||| |||| |
|
|
| T |
23448970 |
ccatgaacttagcttatttggtaagggataatgcacaatatgtgcaggggttggggttcgaaccccgaacaccccacttattcat-tttaaggtggattt |
23449068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 185
Target Start/End: Complemental strand, 27862929 - 27862842
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| ||| |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
27862929 |
ccatgagcttagctcatttgataagggataatgcacaatttgtgcaggggctggggttcgaaccccggacaccccacttattcatctt |
27862842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 49811502 - 49811384
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||| ||| || ||||| | |||||||||||| | |||||||||||||| ||||||| |||||||||| |
|
|
| T |
49811502 |
tgagcttatctcacttggtaaggaataatgcatattatatgtagggg-cagggttcgaacccataataccccacttattcacctttaagatgaatttctc |
49811404 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
49811403 |
tagccgctaggctacttgac |
49811384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 22341960 - 22341838
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| ||||||||||| ||||||||| |||||||| |||||| ||||||| || ||| ||||||||||| |||||||| ||||||||||| |
|
|
| T |
22341960 |
ccatgaacttaaatcatttggtaaaagataatgcacaatatgtgtaggggttggggttcaaatcccaaacaccccacttgttcatcttaaaggtgaattt |
22341861 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| || |||||||||||||| |
|
|
| T |
22341860 |
ctctaaccgctaggctacttgac |
22341838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 8690214 - 8690332
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
||||| || |||| |||| ||||| ||||||| || || |||||||||||||||||||||||||||||||||||||||||| || || ||||||| || |
|
|
| T |
8690214 |
tgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tc |
8690311 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
8690312 |
tagccactaggctacctgacc |
8690332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 205
Target Start/End: Original strand, 21200550 - 21200633
Alignment:
| Q |
123 |
ggataatgcataat--atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
|||||||||||||| || ||||||||||||||||||||| |||| ||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
21200550 |
ggataatgcataatttatatgcaggggtcggggttcgaactccggtcaccccacttattca-ctttaaggtgaatttctctagcc |
21200633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 104 - 217
Target Start/End: Original strand, 8716556 - 8716667
Alignment:
| Q |
104 |
agcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
||||||||||||||||||| |||||||||| |||||||||| ||| || ||||||||| ||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
8716556 |
agcttatctcatttggtaagggataatgcacaatatgtgca-gggccgaggttcgaactccggacattccacttattcatc--taaggtgaatttctcta |
8716652 |
T |
 |
| Q |
203 |
gccactaggctactt |
217 |
Q |
| |
|
||||| ||||||| |
|
|
| T |
8716653 |
atcactaagctactt |
8716667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 115 - 221
Target Start/End: Original strand, 24570223 - 24570330
Alignment:
| Q |
115 |
tttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggct |
213 |
Q |
| |
|
|||||||||| |||||||| ||||| || |||||| ||||||||||||||| |||||| ||||||||| ||||||||||||||||| |||||| | || |
|
|
| T |
24570223 |
tttggtaagggataatgcacaatatatgtaggggttggggttcgaaccccgaacaccctacttattcaactttaaggtgaatttcttcggccactggact |
24570322 |
T |
 |
| Q |
214 |
acttgacc |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
24570323 |
acttgacc |
24570330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 13578531 - 13578457
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13578531 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccactt |
13578457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 123 - 217
Target Start/End: Complemental strand, 29889851 - 29889757
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||||||||| |||| ||||| ||||||| |||||||||||||||||||||| ||||||||||| |
|
|
| T |
29889851 |
ggataatgcatattatatgcaggggccggggttcgaacttcggatgccccatttattcacatttaaggtgaatttctctagccgctaggctactt |
29889757 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 51707117 - 51707238
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||| ||||||||||| | ||| |||||||||||| | |||||| ||||||||||||||||||||||||| |
|
|
| T |
51707117 |
ccatgagcttaactcatttagtaagggataatacataatatgtgtacgggctggggttcgaacctcaaacaccc-acttattcatctttaaggtgaattt |
51707215 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|| | ||||||| ||||||||| |
|
|
| T |
51707216 |
ctttggccactaaactacttgac |
51707238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 9692962 - 9693080
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
||||| || |||| |||| | ||||||||||| || || |||||||| ||||||||||||||||||||||||||||||||| || || ||||||| || |
|
|
| T |
9692962 |
tgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tc |
9693059 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||| ||||| |
|
|
| T |
9693060 |
tagccactaggctacctgacc |
9693080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 121 - 220
Target Start/End: Original strand, 35305001 - 35305101
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt-attcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||||| ||| ||||||| |||| |||||||||||||| ||||| || ||||| |||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
35305001 |
aaggataatgcatattatatgcagggatcggtattcgaaccccggactccccaatttattcacttttaaggtgattttctctagccgctaggctacttga |
35305100 |
T |
 |
| Q |
220 |
c |
220 |
Q |
| |
|
| |
|
|
| T |
35305101 |
c |
35305101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 102 - 221
Target Start/End: Complemental strand, 42411549 - 42411430
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttt--aaggtgaatttc |
198 |
Q |
| |
|
||||| || |||| |||| | ||| |||||||||| || |||||||||||||||||||||||||||||||||||||||| | |||| || ||||||| |
|
|
| T |
42411549 |
tgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattta-ctttaaaaagtgaatt-- |
42411453 |
T |
 |
| Q |
199 |
tctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
42411452 |
tctagccactaggctacttgacc |
42411430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 25104327 - 25104446
Alignment:
| Q |
102 |
tgagcttatctcatttggt-aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||| ||| |||||||||||| ||||||||||||| | || |||||| || || ||| || |||||||||||||||||||||||||| |
|
|
| T |
25104327 |
tgagcttagctcattcggtgaaggataatgcacaatatgtgcagggaccaggattcgaattccagatacctcatttattcatctttaaggtgaatttctc |
25104426 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
25104427 |
cggccactagactacttgac |
25104446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 213
Target Start/End: Complemental strand, 8716488 - 8716371
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttt--aaggtgaat |
195 |
Q |
| |
|
|||||| |||| |||||||| ||||| |||||||| ||||||||||| ||| ||||||||||| ||||||||||||||| |||||| ||| ||||| |
|
|
| T |
8716488 |
ccatgaacttagctcatttgataagggataatgcacaatatgtgcagaagtcaaggttcgaaccctcgacaccccacttatttatctttaaaagatgaat |
8716389 |
T |
 |
| Q |
196 |
ttctctagccactaggct |
213 |
Q |
| |
|
||||||||| |||||||| |
|
|
| T |
8716388 |
ttctctagctactaggct |
8716371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 8965098 - 8965172
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
8965098 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
8965172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 28520787 - 28520708
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
28520787 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
28520708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 123 - 220
Target Start/End: Complemental strand, 2766831 - 2766734
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| || | |||||||| |||| |||||||||| | |||| |||| |||| |||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
2766831 |
ggataatgcattatgtatgcaggggccgggattcgaaccccaggcacctcactatttcacctttaaggtgaatttctccagccgctaggctacttgac |
2766734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 14149832 - 14149910
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||| |||| |
|
|
| T |
14149832 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgac |
14149910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 129 - 214
Target Start/End: Complemental strand, 19688936 - 19688852
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||| |||||||| ||||| |||| |||||||||| ||||| ||||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
19688936 |
tgcacaatatgtgtaggggccggg-ttcgaaccccagacacttcacttctttatctttaaggtgaatttctctagccactaggcta |
19688852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 48968266 - 48968188
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||| |||| |
|
|
| T |
48968266 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgac |
48968188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 126 - 205
Target Start/End: Complemental strand, 15334864 - 15334784
Alignment:
| Q |
126 |
taatgcataatatgtgcaggggtcggggttcgaaccccggacacccca-cttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
||||||||||||| |||||||| | ||||| ||||||||||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
15334864 |
taatgcataatatatgcaggggccagggtttgaaccccggacaccccattttattcacctttatggtgaatttctctagcc |
15334784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 21935483 - 21935555
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21935483 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
21935555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 170 - 217
Target Start/End: Original strand, 2931133 - 2931180
Alignment:
| Q |
170 |
cccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
2931133 |
cccacttattcatctttaaggtgaatttctctagccactagactactt |
2931180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 3036121 - 3036047
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
3036121 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacaccccactt |
3036047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 34353783 - 34353857
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
34353783 |
tgagcttagctcagttggtagggatattgcatattatatgcagaggtcagggttcgaaccccggacaccccactt |
34353857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 116 - 196
Target Start/End: Complemental strand, 37032260 - 37032178
Alignment:
| Q |
116 |
ttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||| ||||| ||||||| || || ||||||||||||| |||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
37032260 |
ttggcaaggacaatgcattattatatgcaggggtcgggattcgaaccccggacaccccacttattcaccttataaggtgaatt |
37032178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 39023179 - 39023253
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
39023179 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacactccactt |
39023253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 172
Target Start/End: Original strand, 49901486 - 49901556
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
49901486 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacacccc |
49901556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 50457780 - 50457706
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||| ||| |||||||| | ||||||||||||||||||| |||||| |
|
|
| T |
50457780 |
tgagcttagctcagttggtaaggatattgcatattatatgcaggggccagggttcgaaccccggacactccactt |
50457706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 54593833 - 54593737
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||| | ||||||||||||| || ||| | ||||| ||||||||| |||| ||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
54593833 |
ggataatgcataatttatgcaggggtcgggttt-gaagctcggactccccacttaatcat-tttaaggtgaatttctcaagctgctaggctacttgacc |
54593737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 6637778 - 6637721
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||| ||||||||||||||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
6637778 |
tgcaggggttggggttcgaaccccgaacaccccacttattcatcttataaggtgaatt |
6637721 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 12820461 - 12820389
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
12820461 |
tgcaggggtcggggttagaaccctggacaccccacttattcaccttataaggtgaat---tctagccactaggcta |
12820389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 121 - 202
Target Start/End: Original strand, 22525409 - 22525489
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||||||||| ||| ||||| | |||| |||||| ||||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
22525409 |
aaggataatgcatattatatgcagaagccggg-ttcgaatcccggacaccccacttattcacctttaagatgaatttctcta |
22525489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 24234130 - 24234073
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24234130 |
tgcaggggccggggtttgaaccccggacaccccacttattcatcttataaggtgaatt |
24234073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 30057235 - 30057300
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| ||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30057235 |
ctcagttggtagggatattgcatattatatgcaggggtcggggttcaaaccccggacaccccactt |
30057300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 36954176 - 36954254
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||| || || ||||||| |||||| |||||||||| |||| |
|
|
| T |
36954176 |
tgcaggggtcggggttcgaaccccggacaccccatttattcactttaaaagtgaatt--tctagctactaggctacctgac |
36954254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 42134526 - 42134449
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| || ||| ||||| |||||| ||| |||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
42134526 |
ccatgagcttaactcagttagtagggatattgcatattatatgcaagggtcggggttcgaactccggacaccccactt |
42134449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 47018002 - 47017945
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
47018002 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
47017945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 52031246 - 52031324
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| || || ||||||| ||||||||||| ||||| |||| |
|
|
| T |
52031246 |
tgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaagtgaatt--tctagccactatgctacctgac |
52031324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 10098164 - 10098243
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||||||| |||| ||||| |||||||||||| |||| ||||| |
|
|
| T |
10098164 |
tgcaggggccgggattcgaaccccggacaccccacttattcatcttataagatgaat---tctagccactagactacctgacc |
10098243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 10402435 - 10402519
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| || |||||||| |||| |||||| |||| |||||| ||| |||||||||||| |||||||||||||||||| ||||| |
|
|
| T |
10402435 |
tcaatccccgtgagcttaactcagttggtagagatattgcatattatatgcaggggtcggagttcgaaccccggacacctcactt |
10402519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 122 - 196
Target Start/End: Original strand, 12856204 - 12856280
Alignment:
| Q |
122 |
aggataatgca-taatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||| || ||| || ||||||||| ||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
12856204 |
aggataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttattcaccttataaggtgaatt |
12856280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 20753178 - 20753103
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||||||||||||||||||| |||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
20753178 |
aggggccggggttcgaaccccggacaccacacttattcaccttataaggtgaat---tctagccactaggctacctgac |
20753103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 21476137 - 21476058
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| |||||||| ||||||| |||||||||||||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
21476137 |
tgcaggggtcgatgttcgaactccggacatcccacttattcatcttataaagtgaat---tctagccactaggctacttgacc |
21476058 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 217
Target Start/End: Original strand, 49607940 - 49607992
Alignment:
| Q |
165 |
gacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||| |||||| |
|
|
| T |
49607940 |
gacaccccacttatttacctttaaggtgaatttctctagccactagactactt |
49607992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 6371118 - 6371197
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |||| |
|
|
| T |
6371118 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccacttcttca |
6371197 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 30295553 - 30295631
Alignment:
| Q |
141 |
gcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30295553 |
gcaggggttggggttcgaaccccagacaccccacttattcaccttagaaggtgaat---tctagccactaggctacctgacc |
30295631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 141 - 221
Target Start/End: Original strand, 30324455 - 30324533
Alignment:
| Q |
141 |
gcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| ||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
30324455 |
gcaggggttggggttcgaaccccagacaccccacttattcaccttagaaggtgaat---tctagccactaggctacctgacc |
30324533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 115 - 193
Target Start/End: Complemental strand, 41272060 - 41271981
Alignment:
| Q |
115 |
tttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtga |
193 |
Q |
| |
|
|||||||||| |||||| | ||| | ||||||| || |||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
41272060 |
tttggtaagggataatgtacaatttatgcagggttcagggttcgaactccggacaccccacttattcatcttaaaggtga |
41271981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 46105530 - 46105613
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
46105530 |
caatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
46105613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 158 - 205
Target Start/End: Original strand, 49607607 - 49607654
Alignment:
| Q |
158 |
aaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
49607607 |
aaccccagacaccccacttattcacctttaaggtgaatttctctagcc |
49607654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 185
Target Start/End: Original strand, 52366204 - 52366291
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| ||||||||||||||| | ||||||||| | ||||| |||||||||||||| |
|
|
| T |
52366204 |
ccatgagtttaactcatttggtaagggataatgcacaatatgtgcaggggttgaagttcgaaccatgaacacctcacttattcatctt |
52366291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 624484 - 624558
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||| | |||||||| | |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
624484 |
tgagcttaactcagttggtaaggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccactt |
624558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 3465622 - 3465695
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||| ||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||| |||| |
|
|
| T |
3465622 |
tgcaggggccggagttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactagactac |
3465695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4958622 - 4958548
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
4958622 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
4958548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 5179944 - 5179874
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||||||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
5179944 |
cttaactcagttggtaaggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
5179874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 6930576 - 6930674
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaag--gtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||||||| |||||||| |||| ||| ||| |||||||||||||||||||| ||||||| |||||| ||| || ||||||||||||||| |
|
|
| T |
6930576 |
ggatattgcataatatatgcaggggccgggattcaaactccggacaccccacttattcacctttaagaggtgaatatct--agttactaggctacttgac |
6930673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 9924895 - 9924953
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| ||| || ||||||||| |
|
|
| T |
9924895 |
tgcaggggtcggggttcgaaccccggacactccacttattcaccttgtatggtgaattt |
9924953 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 11294904 - 11294830
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11294904 |
tgagcttaactcaattggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
11294830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 11375955 - 11375881
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
11375955 |
tgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcactt |
11375881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 12504709 - 12504635
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||| ||| |||||| |||| ||||||||||||||| || |||||| |
|
|
| T |
12504709 |
tgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccactt |
12504635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 181
Target Start/End: Complemental strand, 13264343 - 13264261
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||| |||| |||||| ||||| |||||| ||| |||| || |||||||||||||||||||||||||||| |||| |
|
|
| T |
13264343 |
ccatgagcttcgctcagttggtagggatattgcatattatatgcaaggaccggggttcgaaccccggacaccccacttcttca |
13264261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 22230500 - 22230426
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
22230500 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
22230426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 24253194 - 24253128
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||| |||||||| ||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
24253194 |
ctcatttgataagggataatgcacaatttgtgctggggtcagggttcgaaccccggacaccccactt |
24253128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 180
Target Start/End: Original strand, 25780510 - 25780592
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca-ccccacttattc |
180 |
Q |
| |
|
||||||||||| |||| |||| ||||| | |||||||||| ||||||||||| ||||||||| ||||||| || ||||||||| |
|
|
| T |
25780510 |
ccatgagcttaactcaattggcaaggacattgcataatatatgcaggggtcgtggttcgaacgccggacatcctcacttattc |
25780592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 154 - 221
Target Start/End: Complemental strand, 29269357 - 29269292
Alignment:
| Q |
154 |
ttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || ||||||||| ||||||||||||||| ||||| |
|
|
| T |
29269357 |
ttcgaaccccggacaccccacttattcatcttatatggtgaattt---tagccactaggctacctgacc |
29269292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 29406361 - 29406435
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | ||||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
29406361 |
tgagcttagctcaattggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaacccactt |
29406435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 29771365 - 29771291
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
29771365 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggccggggttcgaaccccgggcactccactt |
29771291 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 123 - 205
Target Start/End: Original strand, 32037589 - 32037671
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||| || || ||| | |||| ||||||| ||||| |||||||||||||||| |
|
|
| T |
32037589 |
ggataatgcatattatatgcaggggtcggggttcaaatcctggatatcccatttattcacatttaaagtgaatttctctagcc |
32037671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 33933805 - 33933731
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||||| |||||||| |||||||||| ||| ||||||||||||| |
|
|
| T |
33933805 |
tgagcttagctcagttggtagggacattgcataatatatgcaggggccggggttcgacccctggacaccccactt |
33933731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 36008314 - 36008387
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| ||| |||||||||| ||||||||||| ||||| |
|
|
| T |
36008314 |
tgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaat---tctagccactaagctac |
36008387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 36257733 - 36257812
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatcttt--aaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |||| || |||||| |||||||||||||||||| |||| |
|
|
| T |
36257733 |
tgcaggggccggggttcgaaccccggacaccccacttattca-ctttaaaaagtgaat---tctagccactaggctactagacc |
36257812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 38848186 - 38848112
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataa-tatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||| | ||||| ||||||| | | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38848186 |
gagcttagctcaattggcagggatattgcataaatttatgcaggggtcggggttcgaaccccggacaccccactt |
38848112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 40051626 - 40051700
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || |||||| |||||||||||||| |||||||||||| |
|
|
| T |
40051626 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggtaggggttcgaaccccagacaccccactt |
40051700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 43147450 - 43147376
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
43147450 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
43147376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 43596899 - 43596973
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
43596899 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
43596973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 43905718 - 43905788
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| ||||| ||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43905718 |
cttaactcagttggtagggatattgcatgttatatgcagggatcggggttcgaaccccggacaccccactt |
43905788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 45112177 - 45112103
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
45112177 |
tgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
45112103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 46775096 - 46775022
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
46775096 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
46775022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 47929249 - 47929323
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||||||||| || ||| |||||| ||| ||||||||||| |||||||||| |||| ||||||||| |
|
|
| T |
47929249 |
tgagcttagctcatttggtgagaatattgcatattatatgcaggggtcgaggttcgaacctcggaaaccccactt |
47929323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 47934138 - 47934064
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
47934138 |
tgagcttagctcagttggtagggatatggcatattatatgcaggggccggggttcgaaccccggacactccactt |
47934064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 51890801 - 51890875
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51890801 |
tgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
51890875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 53698036 - 53697963
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| | ||| |||||||||| |||||| |||||||||| |
|
|
| T |
53698036 |
tgcaggggccggggttcgaaccccggacaccccacttatttaccttataaggtgaat---tctagcaactaggctac |
53697963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 53815735 - 53815814
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| | || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
53815735 |
tgcaggggctggggttcgaaccccggacaccccacttattcactataaaagtgaatt--tctagccactaggctacctgacc |
53815814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 55251417 - 55251343
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
55251417 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
55251343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 127 - 220
Target Start/End: Original strand, 55433212 - 55433306
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||||| |||||| ||||||||||| || ||||||| ||||||||| || || |||||||||||||||||| || ||||||||| |
|
|
| T |
55433212 |
aatgcacaatatgtgtaggggttggggttcgaactccagacacccaacttattcacattaaaaagtgaatttctctagccaccagactacttgac |
55433306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 94 - 176
Target Start/End: Complemental strand, 56088028 - 56087946
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| |||| |||||| ||||| ||||| ||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
56088028 |
aatccccataagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaatcccggacaccccactt |
56087946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 56479288 - 56479219
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
56479288 |
cttaactcagttggtagggatattgcatattatatgcaggggtcggg-ttcgaaccccggacaccccactt |
56479219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 9084798 - 9084843
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| |
|
|
| T |
9084798 |
tgcaggggtcgggattcgaacctcggacaccccacttattcatctt |
9084843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 10417290 - 10417213
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| | |||| ||| |||||| ||| ||||||||||||||||||| |||||| |
|
|
| T |
10417290 |
ccatgagcttagctcagttggtagggatattacatattatatgcaggagtcagggttcgaaccccggacactccactt |
10417213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 32885727 - 32885784
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32885727 |
tgcaggggtcggagttcgaacctcggacaccccacttattcaccttataaggtgaatt |
32885784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 33076569 - 33076610
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
33076569 |
tgcaggggtcggggttcgaaccccggacaccctacttattca |
33076610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 35733374 - 35733491
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| || | ||||||||| |||| ||||||| ||||||| ||| | || ||| |||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
35733374 |
tgagcttagcttacttggtaagggataacgcataattgatgcagggctcgagattggaattccggacaccccacttattcacctttaaggtgagtttctt |
35733473 |
T |
 |
| Q |
201 |
tagccactaggctacttg |
218 |
Q |
| |
|
||||| |||| ||||||| |
|
|
| T |
35733474 |
tagccgctagactacttg |
35733491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 40150514 - 40150571
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||| || || |||||||||| |
|
|
| T |
40150514 |
caggggtcggggttcgaaccccggacacctcacttattcactttaaaagtgaatttct |
40150571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 188
Target Start/End: Complemental strand, 41137977 - 41137900
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||| |||||| ||| | |||||||||| ||||||||| |||||||||||| | |||||||||||| ||||| ||||| |
|
|
| T |
41137977 |
ctcagttggtagggacattgcataatatatgcaggggttggggttcgaaccacagacaccccacttcttcatatttaa |
41137900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 49319432 - 49319473
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
49319432 |
tgcaggggtcggggttccaaccccggacaccccacttattca |
49319473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 49447122 - 49447199
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||||||||| |||||| ||| || ||| | |||||||||||||| |||||| |||||| |
|
|
| T |
49447122 |
ccatgagcttagctcagttggtaaggatattgcatattatatgtaggagccggggttcgaaccctggacactccactt |
49447199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 2222557 - 2222617
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| ||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
2222557 |
ttggtagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccactt |
2222617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 2629585 - 2629657
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||| | ||| | |||||||| | ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
2629585 |
agcttagctcaattggcagggacattgcataatttatgcaggggtcggggttcgaaccccgaacaccccactt |
2629657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 206
Target Start/End: Original strand, 20241420 - 20241476
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcca |
206 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
20241420 |
gggggtcgaacttcggacaccccactttttcatcttaaaggtgaatttctctagcca |
20241476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 125 - 209
Target Start/End: Complemental strand, 23234020 - 23233936
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||| ||| ||||||||||| | ||||| ||| || ||||||||||||||||| || || |||||||| ||||||||||| |
|
|
| T |
23234020 |
ataatgcacaatttgtgcaggggttgtggttcaaactccaaacaccccacttattcatattaaaagtgaatttttctagccacta |
23233936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 103 - 187
Target Start/End: Original strand, 25224477 - 25224561
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta |
187 |
Q |
| |
|
||||||| |||| ||||| ||| | |||||||| | |||||||||||| ||||||||| |||||||||||||| ||||| |||| |
|
|
| T |
25224477 |
gagcttaactcaactggtagggacattgcataatttatgcaggggtcggagttcgaacctcggacaccccacttcttcatattta |
25224561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 31261802 - 31261681
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcgg----ggttcgaaccccggacaccccacttattcatctttaaggtga |
193 |
Q |
| |
|
||||||||||| ||||||| ||||| |||||||| ||| |||| |||||| || ||||||||||||| |||||| ||||||||||||| |||| |
|
|
| T |
31261802 |
ccatgagcttaattcatttgataagggataatgcacaatgtgtgaaggggtgggttggggttcgaaccccgaacaccc-acttattcatctt----gtga |
31261708 |
T |
 |
| Q |
194 |
atttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| ||||||||| ||||||||| |
|
|
| T |
31261707 |
atttctccagccactagactacttgac |
31261681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 195
Target Start/End: Complemental strand, 35747538 - 35747482
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaat |
195 |
Q |
| |
|
||||||||||| ||||||||| |||||||||||||||||||| ||| |||||||||| |
|
|
| T |
35747538 |
tgcaggggtcgaggttcgaactccggacaccccacttattcaccttataaggtgaat |
35747482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 185
Target Start/End: Original strand, 37274628 - 37274664
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37274628 |
cggggttcgaaccccggacaccccacttattcatctt |
37274664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 39387475 - 39387590
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| |||||||||||||| |||||||||||| |||||||||| | | ||||||||| |||| || ||||||||| | ||||||| |
|
|
| T |
39387475 |
ccatgaacttagctcatttggtaagggataatgcataatttgtgcaggggcccgacttcgaaccctagacatcctacttattcacc-------tgaattt |
39387567 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
39387568 |
ctctaaccactaggctacttgac |
39387590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 43978012 - 43978072
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
43978012 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
43978072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 145 - 196
Target Start/End: Complemental strand, 45141284 - 45141232
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||| || ||||||||||| |
|
|
| T |
45141284 |
gggtcggggttcgaaccccggacacctcacttattcatgttataaggtgaatt |
45141232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 179
Target Start/End: Complemental strand, 55308133 - 55308053
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||||| |||| |||||| | |||||||||||||||| | ||||||| || || |||||||||| ||||||||||||||| |
|
|
| T |
55308133 |
ccatgaacttaactcattggtaaaggataatgcataatttatgcagggatcaggattcgaaccccagacaccccacttatt |
55308053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 194
Target Start/End: Complemental strand, 2304411 - 2304340
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaa |
194 |
Q |
| |
|
||||||| |||||||| ||||| || ||| |||||||| ||||| |||||||||||||| ||||||||||| |
|
|
| T |
2304411 |
ggataatacataatatatgcagcggccggagttcgaacgccggataccccacttattcacatttaaggtgaa |
2304340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 8848278 - 8848207
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| | |||||| ||||||||||||||||||||||||| |
|
|
| T |
8848278 |
tgagcttagttcagttggtagggatattgcatattatatacaggggccggggttcgaaccccggacacccca |
8848207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 13539933 - 13539816
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||| | | ||||||| ||||||||||||| ||||| || ||||||| ||| |||||||||||||| |
|
|
| T |
13539933 |
tgagcttagctcacttggtaagggataatgcatatt-tatgcagggactagggttcgaaccccaaacacctcatttattcacctt-aaggtgaatttctc |
13539836 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
| ||| |||||||||||||| |
|
|
| T |
13539835 |
tggccgctaggctacttgac |
13539816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 14794917 - 14795020
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| | | ||||| || |||||||||| | |||||| ||||||| | ||||||||||||| |||| |
|
|
| T |
14794917 |
tgagcttagttcatttggtaaggaataatgcataatttaagtgggggttggagttcgaaccctgaacaccctacttatttacctttaaggtgaatatctc |
14795016 |
T |
 |
| Q |
201 |
tagc |
204 |
Q |
| |
|
|||| |
|
|
| T |
14795017 |
tagc |
14795020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 173
Target Start/End: Complemental strand, 23176791 - 23176716
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||||| |||| |||||| ||| || ||||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
23176791 |
ccatgagctttgctcagttggtagggacaaatgcattttatatgcaggggtcggggttcgaaccccggacacccca |
23176716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 215
Target Start/End: Complemental strand, 28221352 - 28221290
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||| |||||||||| |||| |||||||||||| |
|
|
| T |
28221352 |
gggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctaaccactaggctac |
28221290 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 31852679 - 31852612
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||||||||||| |||||| || || |||||| ||| || |||||| |||||||||||||||||||| |
|
|
| T |
31852679 |
tgagcttatctcagttggtagggttattgcatattatatgtaggggttggggttcgaaccccggacac |
31852612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 176
Target Start/End: Complemental strand, 35219579 - 35219493
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| ||| || |||||||| |||| |||||| ||||| |||||| || |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35219579 |
aaatctatccccgtgagcttagctcagttggtagggatattgcatattaa-tgcaggagtcggggttcgaaccccggacactccactt |
35219493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 170
Target Start/End: Complemental strand, 46676561 - 46676490
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||| |||| || |||||||||| |||| |||||| |
|
|
| T |
46676561 |
ccatgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgacccccagacacc |
46676490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 49280725 - 49280647
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||| |||||| ||||||| |||||||||| ||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
49280725 |
tgcaggggtcggtgtttgaaccctggacacctcacttattcaccttataaggtgaat---tctaaccactaggctacttgac |
49280647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 135 - 198
Target Start/End: Complemental strand, 52330970 - 52330907
Alignment:
| Q |
135 |
atatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||||||||||| || || ||||||||| |
|
|
| T |
52330970 |
atatatgcaggggccggggttcgaactccggacaccccacttattcactttaaaagtgaatttc |
52330907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 179
Target Start/End: Complemental strand, 53355022 - 53354983
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
53355022 |
tgcaggggccggggttcgaaccccggacaccccacttatt |
53354983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 94 - 169
Target Start/End: Original strand, 55021550 - 55021625
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| ||| ||| ||| |||| |||||| | ||| |||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
55021550 |
aatctccacgaggttagctcagttggtaggaatattgcatattatatgcaggggtcggggttcgaaccccggacac |
55021625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 205
Target Start/End: Original strand, 2824634 - 2824696
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
||||||||| |||||||| ||||||| |||||| |||| |||||||||||||||||| |||| |
|
|
| T |
2824634 |
aggggtcggagttcgaactccggacatcccactatttcacctttaaggtgaatttctccagcc |
2824696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 12582094 - 12582020
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| | |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
12582094 |
tgagctaatcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
12582020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 12625833 - 12625907
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||||||||| |||||||| | |||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
12625833 |
tgagctttactcagttggtaaggacgttgcataatttatgcaggggtcggagttcgaacaccggacaccccactt |
12625907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 182
Target Start/End: Complemental strand, 13211408 - 13211366
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||| ||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
13211408 |
tgcatgggtcggggttcgaaccccggacactccacttattcat |
13211366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 15604106 - 15604032
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| ||||| ||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
15604106 |
tgagcttagctcagttggtagggatgttgcattttatatgcaggggtcgggattcgaaccccggacactccactt |
15604032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 22788740 - 22788666
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| || |||| ||| |||||||||||||||| |
|
|
| T |
22788740 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggtttgaatcccggacaccccactt |
22788666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 188
Target Start/End: Complemental strand, 27308771 - 27308685
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||||||| || | |||||| ||| || ||||||||| ||||||||||||||||||||| |||||||| | ||||| ||| ||||| |
|
|
| T |
27308771 |
tgagcttagcttaattggtagggacaacgcataatatatgcaggggtcggggttcgaacttcggacacctcccttatccatatttaa |
27308685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 220
Target Start/End: Complemental strand, 32296428 - 32296318
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
||||||| |||||| |||| ||||||||| || | |||| | |||||||| | ||||| |||| |||||||||||||| |||||||| | ||||||||| |
|
|
| T |
32296428 |
ctcattttgtaagggataaagcataatatatgtatgggttgaagttcgaactctggacatcccatttattcatctttaaagtgaatttttttagccacta |
32296329 |
T |
 |
| Q |
210 |
ggctacttgac |
220 |
Q |
| |
|
| |||||||| |
|
|
| T |
32296328 |
gattacttgac |
32296318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 220
Target Start/End: Complemental strand, 33944438 - 33944341
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||| || || |||||||| ||||||||||||| || | || |||||||||||| || |||||||||| ||||||||||||||||| ||| |
|
|
| T |
33944438 |
aggataatgcattattatatgcaggggccggggttcgaacctcgaatactccacttattcattttataaggtgaat---tctagccactaggctacctga |
33944342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 36132233 - 36132307
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| | ||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
36132233 |
tgagtttagctcaattggtaggaatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
36132307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 181
Target Start/End: Original strand, 40486466 - 40486524
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||||| | |||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
40486466 |
ggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttca |
40486524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42231516 - 42231590
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| | ||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
42231516 |
tgagcttaactcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
42231590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42395231 - 42395305
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| || ||||| |||||||||||| ||||||||||||||| |
|
|
| T |
42395231 |
tgagcttagcttagttggtagggatattgcatattatatgtaggggccggggttcgaactccggacaccccactt |
42395305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 45139947 - 45139873
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | || ||||| | |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
45139947 |
tgagcttagctcagttggtagggacattgtataatttatgcaggggccggggttcgaaccccggacacctcactt |
45139873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 46206581 - 46206647
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| |||||| ||| | ||||| |||| ||||||||||||| ||||||||||||||| |
|
|
| T |
46206581 |
tgagcttagctcagttggtagggacattgcattatatatgcaggggtcgggattcgaaccccggaca |
46206647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 48569242 - 48569168
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
48569242 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
48569168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 150 - 217
Target Start/End: Complemental strand, 49039491 - 49039424
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt---taaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
49039491 |
ggggttcgaaccccggacaccccacttattcaccttgaaaaaggtgaat---tctagccactaggctactt |
49039424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 55055920 - 55055994
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||| | | |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
55055920 |
tgagcttagctcagttggtagggacaatgcatattttatgcaggggccgaggttcgaaccccggacacgccactt |
55055994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 147 - 185
Target Start/End: Complemental strand, 55485875 - 55485837
Alignment:
| Q |
147 |
gtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
55485875 |
gtcggggttcgaaccccagacaccccacttattcatctt |
55485837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 196
Target Start/End: Original strand, 3442886 - 3442939
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||| ||||||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
3442886 |
ggggccggggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
3442939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 7768844 - 7768803
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| |
|
|
| T |
7768844 |
tgcagaggccggggttcgaaccccggacaccccacttattca |
7768803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 9285705 - 9285637
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||| ||||||||||||||| | ||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
9285705 |
ggggttcgaaccccagacaccccacttattaaccttataaggtgaat---tctagccactagactacttgac |
9285637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 165 - 214
Target Start/End: Complemental strand, 17329154 - 17329105
Alignment:
| Q |
165 |
gacaccccacttattcatctttaaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||||||||||| |||||||| |||||||||| | ||||||||||| |
|
|
| T |
17329154 |
gacaccccacttattcctctttaagatgaatttctccaaccactaggcta |
17329105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 116 - 169
Target Start/End: Original strand, 19963800 - 19963853
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||||||||||||||| ||||||| |
|
|
| T |
19963800 |
ttggtagggatattgcatattatatgcaggggtcggggttcgaacctcggacac |
19963853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 180
Target Start/End: Original strand, 29584645 - 29584725
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||||||| |||| |||| | ||| | |||||||| | |||||||| || ||||||||||||||||||| ||||||||| |
|
|
| T |
29584645 |
ccatgagcttagctcaattggca-ggacattgcataatttatgcaggggccgaggttcgaaccccggacacctcacttattc |
29584725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 32339329 - 32339402
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| ||| || ||||| |||||| ||| |||| |||||||||||| |||||| |||||||||||| |
|
|
| T |
32339329 |
gagcttaactcagttgttagggatattgcatattatatgcaagggtcggggttcaaaccccagacaccccactt |
32339402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 191
Target Start/End: Original strand, 34974750 - 34974791
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
34974750 |
ggggttcgaaccccggacaccccacttattctcctttaaggt |
34974791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 36099224 - 36099175
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36099224 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
36099175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 183
Target Start/End: Complemental strand, 41971397 - 41971313
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatc |
183 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| ||| ||||||| | || | |||||| |||||||| |||||||||||||| |
|
|
| T |
41971397 |
ccatgagcttagctcatttggtaagtgataatgcacaatttgtgcagcgaccgagattcgaatcccggaca-cccacttattcatc |
41971313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 45350315 - 45350356
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45350315 |
tgcagaggtcggagttcgaaccccggacaccccacttattca |
45350356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 45359794 - 45359835
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
45359794 |
tgcagaggtcggagttcgaaccccggacaccccacttattca |
45359835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 47890708 - 47890773
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| |||| |||||| ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
47890708 |
ctcagttggtagagatattgcatattatatgcaggggtcggggttcgaaccccagacactccactt |
47890773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 151 - 221
Target Start/End: Original strand, 48512249 - 48512317
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| |||||||||||| |||||||||| ||| |||||| |
|
|
| T |
48512249 |
gggttcgtaccccggacaccccacttattcaccttataaggtgaattt---tagccactagactatttgacc |
48512317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 52556940 - 52557017
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| ||||||||||| ||| | | |||||| | | ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
52556940 |
ccatgagcttagctcatttggtagggacattacataatttatacagaggtcggggttcgaacccctaacaccccactt |
52557017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 53376744 - 53376671
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||||| ||||| ||||| ||| |||| ||| ||||||||||||||||||||| |||||| |
|
|
| T |
53376744 |
gagcttagctcaattggtagggatattgcatgttatatgcaagggccggggttcgaaccccggacactccactt |
53376671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 106 - 174
Target Start/End: Original strand, 1439626 - 1439694
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||| |||| |||||| ||| | |||||| ||| |||| ||||||||||||||||||| |||||||||| |
|
|
| T |
1439626 |
cttagctcagttggtatggacattgcatattatatgcaagggtcggggttcgaaccccagacaccccac |
1439694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 1458082 - 1458010
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| ||| || ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
1458082 |
agcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
1458010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 96 - 176
Target Start/End: Original strand, 3784910 - 3784989
Alignment:
| Q |
96 |
tcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||||| |||| |||||| ||||| |||||||| | ||||||| || |||||||||||||| ||||| ||||| |
|
|
| T |
3784910 |
tcaccgtgagcttagctcaattggtagggatattgcataatttatgcaggg-tcagggttcgaaccccgaacaccacactt |
3784989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 7371608 - 7371540
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||| |||||| ||| |||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
7371608 |
tgagcttaactcagttgataaggacaatacataatatatgcaaggtccggggttcgaaccccggacacc |
7371540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 147 - 199
Target Start/End: Original strand, 9759417 - 9759469
Alignment:
| Q |
147 |
gtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||||||| ||| |||||||||||||||| ||| ||||||||||||| |
|
|
| T |
9759417 |
gtcggggttcgaatcccagacaccccacttattctccttcaaggtgaatttct |
9759469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 93 - 169
Target Start/End: Original strand, 9761110 - 9761186
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |
|
|
| T |
9761110 |
caatccccgtgagcttacctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacac |
9761186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 199
Target Start/End: Original strand, 11128746 - 11128818
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||| ||||| | ||||||||| ||||||||||||||| || |||| |||||||| || ||||||||||||| |
|
|
| T |
11128746 |
aatgtataatttatgcaggggtaggggttcgaaccccgaacttcccatttattcattttaaaggtgaatttct |
11128818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 17859820 - 17859895
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||| |||||||||||| ||||| |||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
17859820 |
aggggccggagttcgaaccccgaacacctcacttattcaccttataaggtgaat---tctagccactaggctacctgac |
17859895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 20266863 - 20266981
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggaca-ccccacttattcatctt-taaggtgaatttc |
198 |
Q |
| |
|
|||||||| ||||||||||| ||| ||||||| || || |||||||| | | ||| |||||||||||| ||||||||||||| ||| |||||||||| |
|
|
| T |
20266863 |
tgagcttagctcatttggta-ggacaatgcattattatatgcaggggccagagtttgaaccccggacacccccacttattcaccttataaggtgaat--- |
20266958 |
T |
 |
| Q |
199 |
tctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| ||||||| ||||| |
|
|
| T |
20266959 |
tctagccaccaggctacctgacc |
20266981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 23695126 - 23695162
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||| |
|
|
| T |
23695126 |
tgcaggggtcagggttcgaaccccggacaccccactt |
23695162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 23771337 - 23771289
Alignment:
| Q |
154 |
ttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| |||||| |||||| |
|
|
| T |
23771337 |
ttcgaacctcggacacctcacttattcatctttaaagtgaatctctcta |
23771289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 23778877 - 23778817
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| | |||| ||| ||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
23778877 |
ttggtagggatattacatattatatgcaggggttggggttcgaaccccagacaccccactt |
23778817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 182
Target Start/End: Complemental strand, 27091538 - 27091458
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||| ||| |||| |||||| ||| | || ||||| | |||||||||||| |||||||||||||||| ||||||| ||||| |
|
|
| T |
27091538 |
tgagtttagctcagttggtagggacattgtataatttctgcaggggtcggagttcgaaccccggacatcccacttcttcat |
27091458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 217
Target Start/End: Original strand, 33359856 - 33359933
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt---taaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||| |||||| ||||||||||| |||||||||||||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33359856 |
tgcaagggtcgaggttcgaaccctggacaccccacttattcaccttgaaaaaggtgaat---tctagccactaggctactt |
33359933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 39719817 - 39719781
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
39719817 |
tttaaggtgaatttctctagccactaggctatttgac |
39719781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 196
Target Start/End: Original strand, 44175180 - 44175251
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
||||||||||||||| ||||| ||| ||||| ||||||||||||||||| ||||| ||| |||| ||||||| |
|
|
| T |
44175180 |
gataatgcataatatatgcagaggttagggtttgaaccccggacaccccatttatt-atcattaaagtgaatt |
44175251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 548943 - 548865
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||| | | ||||||||||||||||| ||| |||||||||||| |||| |||||||||| |||| |
|
|
| T |
548943 |
tgcaggggccggggttcgaaactcagacaccccacttattcaccttataaggtgaattt---tagctactaggctacctgac |
548865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 197
Target Start/End: Complemental strand, 6330989 - 6330934
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
|||||| ||||||| || ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
6330989 |
aggggttggggttcaaatcccggacaccccacttattcaccttataaggtgaattt |
6330934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 13088940 - 13088987
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | |||||||||||||||||||| | |||||||||||||| |
|
|
| T |
13088940 |
tgcataatttatgcaggggtcggggttcgaatctcggacaccccactt |
13088987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 123 - 196
Target Start/End: Original strand, 22158268 - 22158343
Alignment:
| Q |
123 |
ggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||| | |||||| || ||||||||| ||| ||||||||||| |
|
|
| T |
22158268 |
ggataatgcattattatatgcaggggtcggggttcgaaactcggacatccaacttattcaccttataaggtgaatt |
22158343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 23924934 - 23924871
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| |||| |||||| ||| | |||||||| | |||||||| ||||||||||||||||||||| |
|
|
| T |
23924934 |
cttaactcaattggtagggacattgcataatttatgcaggggccggggttcgaaccccggacac |
23924871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 26919534 - 26919455
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| |||||||| |||||| |||| |
|
|
| T |
26919534 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccacttcttca |
26919455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 181
Target Start/End: Original strand, 29785199 - 29785230
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
29785199 |
ggggttcgaaccccggacaccccacttattca |
29785230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 181
Target Start/End: Original strand, 30696764 - 30696803
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30696764 |
caggggtcggggttcgaaccccggattccccacttattca |
30696803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 179
Target Start/End: Complemental strand, 35230351 - 35230312
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||| |
|
|
| T |
35230351 |
tgcatgggtcggggttcgaacctcggacaccccacttatt |
35230312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 133 - 217
Target Start/End: Original strand, 39992868 - 39992949
Alignment:
| Q |
133 |
taatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||| |||||||| | ||||||||| | |||||||||||||||||| ||| |||||||||| ||||||||||||||||||| |
|
|
| T |
39992868 |
taatatatgcagggg-ctgggttcgaattctggacaccccacttattcaccttataaggtgaat---tctagccactaggctactt |
39992949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 127 - 201
Target Start/End: Complemental strand, 53096593 - 53096518
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcat-ctttaaggtgaatttctct |
201 |
Q |
| |
|
|||||| ||||||||||||| | ||||||||| | |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
53096593 |
aatgcacaatatgtgcagggactagtgttcgaacctcagacaccccacttattcatccttaaaggtgaatttctct |
53096518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 53758975 - 53759049
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| ||||||||| |||||||||| ||| |||||||||||| ||||||| ||||||||| |||||| |
|
|
| T |
53758975 |
tgagtttagctcaattggtaagggataatgcata-tatatgcaggggtcggagttcgaatcccggacactccactt |
53759049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 55853174 - 55853095
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| |||||||| ||| |||||||||||| ||| ||||||| |||| |
|
|
| T |
55853174 |
tgagcttagctcagttggtagagatattgcatattatatgcaggggccggtgttcgaaccccgaacatcccacttcttca |
55853095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 534821 - 534763
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggaca-ccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||| ||| |||||||| ||||||||||||| ||| ||||||||||| |
|
|
| T |
534821 |
tgcaggggtcggggtttgaatcccggacacccccacttattcaccttataaggtgaatt |
534763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 637103 - 637177
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||||| | ||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
637103 |
tgagcttagctcagctggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
637177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4234351 - 4234277
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||| | ||||||||||||| ||||||| |||||| |
|
|
| T |
4234351 |
tgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaacctcggacactccactt |
4234277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4701004 - 4700930
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| || ||| ||| |||||||||||| || ||||||||||||| ||||||| |
|
|
| T |
4701004 |
tgagtttagctcagttggtagggatattgtatattatatgcaggggtcggtgtccgaaccccggacatcccactt |
4700930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 5165861 - 5165923
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
5165861 |
tgagcttaactcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccg |
5165923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 5305076 - 5305002
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| |||||| | ||| |||| ||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
5305076 |
tgagcttatctcagttggtaggaatatcgcattttatatgcaggggccgaggttcgaaccccggacactccactt |
5305002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 185
Target Start/End: Original strand, 6202653 - 6202687
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||| |
|
|
| T |
6202653 |
gggttcgaaccccggacaccctacttattcatctt |
6202687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 7686328 - 7686254
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| ||||| ||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
7686328 |
tgagcttagctcagttggtagagatattgcattttatatgcaggggccggggttcgaaccctggacactccactt |
7686254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #223
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 148 - 221
Target Start/End: Complemental strand, 15640491 - 15640420
Alignment:
| Q |
148 |
tcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||| | ||||||||||||||||| || || ||||||| |||||||||||| |||| ||||| |
|
|
| T |
15640491 |
tcggggttcgaacctcagacaccccacttattcactttaaaagtgaatt--tctagccactagactacctgacc |
15640420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17815491 - 17815417
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| | |||| ||| |||||||||||||||||||| ||| ||||||| |||| |
|
|
| T |
17815491 |
tgagcttagttcagttggtagggatattacatattatatgcaggggtcggggttcgaatccctgacaccctactt |
17815417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 18360497 - 18360571
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
18360497 |
tgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccactt |
18360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 19908693 - 19908755
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || || ||||||||||||| |
|
|
| T |
19908693 |
tgagcttaactcagttggtaaggacaatgcataatatatgcaaggtccgaggttcgaaccccg |
19908755 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 181
Target Start/End: Complemental strand, 23661411 - 23661373
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
23661411 |
aggggtaggggttcgaaccccgaacaccccacttattca |
23661373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #228
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 24665051 - 24664989
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || |||||||||||||||| |
|
|
| T |
24665051 |
tgagcttagctcagttggtatggagaatgcataatatatgcaaggtccggggttcgaaccccg |
24664989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #229
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 25235863 - 25235789
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
25235863 |
tgagcttagcttagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
25235789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #230
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 26203840 - 26203786
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||| |||||| ||||||| |||| |||||||||||||||| ||||||||||| |
|
|
| T |
26203840 |
aggggttggggtttgaacccctgacatcccacttattcatcttataaggtgaatt |
26203786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #231
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 26868353 - 26868426
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||| |||||||||||||||| |||||| |
|
|
| T |
26868353 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggg-ttcgaaccccggacactccactt |
26868426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #232
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 31578061 - 31578134
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||| |||||| ||||||||||||||||||||| || |||||||||| ||||||||||||||||| |||| |
|
|
| T |
31578061 |
gggttgggattcgaaacccggacaccccacttattcacattataaggtgaat---tctagccactaggctacctgac |
31578134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #233
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 32293112 - 32293178
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| ||| |||||| | |||||||| | |||||||||||||||| |||||| ||||| |
|
|
| T |
32293112 |
tgagcttagctcagttgataaggacattgcataatttatgcaggggtcggggttagaaccctggaca |
32293178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #234
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 33530797 - 33530871
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| || |||| ||||||||||||||||||| || |||||| |
|
|
| T |
33530797 |
tgagcttagcttaattggtagggatattgcatattatatgtagggatcggggttcgaaccccggatactccactt |
33530871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #235
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 177
Target Start/End: Complemental strand, 33993692 - 33993638
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactta |
177 |
Q |
| |
|
||||||| ||||| || ||||||||||||| |||||| |||||||||| |||||| |
|
|
| T |
33993692 |
ggataatacataacatatgcaggggtcgggattcgaatcccggacacctcactta |
33993638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #236
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 36602432 - 36602358
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
36602432 |
tgagcttagctcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccactt |
36602358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #237
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 196
Target Start/End: Original strand, 38433357 - 38433407
Alignment:
| Q |
147 |
gtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
38433357 |
gtcggagttcgaaccccagacaccccacttattcaccttataaggtgaatt |
38433407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #238
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 42381175 - 42381105
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| ||||| ||| || ||||||||||||||||||| | |||||||||||| |
|
|
| T |
42381175 |
cttagctcagttggtagggatattgcatgttatatgtaggggtcggggttcgaacctcagacaccccactt |
42381105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #239
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 43115307 - 43115365
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
||||||||||| | |||||||||||||||||||| ||||||| ||| ||| |||||||| |
|
|
| T |
43115307 |
tgcaggggtcgagattcgaaccccggacaccccatttattcaccttataaagtgaattt |
43115365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #240
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 185
Target Start/End: Original strand, 43337003 - 43337045
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||| |||||||||||| |||| |||||||||||||||||||| |
|
|
| T |
43337003 |
agggatcggggttcgaatcccgaacaccccacttattcatctt |
43337045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #241
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 46998434 - 46998360
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| | ||| || ||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
46998434 |
tgagcttagctcagttggtatgaatattgtatattatatgcaggagccggggttcgaaccccggacactccactt |
46998360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #242
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 52798282 - 52798355
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||| | ||||||||||||||||| |||| |||||| |
|
|
| T |
52798282 |
tgagcttaactcagttggtagggatattgcatattatatgcagag-tcggggttcgaaccccgtacactccactt |
52798355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #243
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 56314800 - 56314873
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||| ||||||||||| |||||||| |||||||||| || ||||||||| ||||||||||||||||| |
|
|
| T |
56314800 |
tgcaggggtcagggttcgaaccacggacaccacacttattcacattaaaaggtgaat---tctagccactaggctac |
56314873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #244
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 56531292 - 56531254
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
56531292 |
tgcaggggccggggttcgaactccggacaccccacttat |
56531254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #245
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 1297892 - 1297949
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||| ||||||||| | |||| ||||||||||| ||| ||||||||||| |
|
|
| T |
1297892 |
tgcaggggtcgggattcgaaccctgaacactccacttattcaccttataaggtgaatt |
1297949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #246
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 1589213 - 1589168
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||| || ||||||||||||||| |||| ||||||||||| |
|
|
| T |
1589213 |
tgcaggggtcaggattcgaaccccggacatcccatttattcatctt |
1589168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #247
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 5430410 - 5430342
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccac-ttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||| ||| |||| ||||| ||||||||||||||||| |||| |
|
|
| T |
5430410 |
gggttcgaaccccggacaccccactttattcaccttataagatgaat---tctagccactaggctacatgac |
5430342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #248
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 6841570 - 6841505
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||||||| | | |||||||| ||||| |||| |||||| ||||||||||||| ||||| |
|
|
| T |
6841570 |
ctcagttggtaaggacattacataatatatgcagtggtcagggttcaaaccccggacacctcactt |
6841505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #249
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 168
Target Start/End: Original strand, 12058317 - 12058386
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
||||||| ||| |||| | ||||||||||||||||||||| |||| || || ||||||||||| ||||| |
|
|
| T |
12058317 |
ccatgagtttagctcagtcggtaaggataatgcataatatatgcaaggttcaaggttcgaaccctggaca |
12058386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #250
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 13161748 - 13161825
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||| ||||| ||||| | |||| | | |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
13161748 |
ccatgaacttagctcagttggttgggatattacatattttatgcaggggtcggggttcgaaccccagacacaccactt |
13161825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #251
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 104 - 173
Target Start/End: Original strand, 16975078 - 16975147
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||| |||| |||||| ||| | |||||||| | |||| ||||| |||||||||||||||| |||||| |
|
|
| T |
16975078 |
agcttagctcaattggtagggacattgcataatttatgcatgggtcagggttcgaaccccggaaacccca |
16975147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #252
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 17617025 - 17616972
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| ||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
17617025 |
ggatattgcattttatatgcaggggccggggttcgaaccccggacactccactt |
17616972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #253
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 20610778 - 20610819
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||| ||||||| |||||||||||| |
|
|
| T |
20610778 |
tgcaggggccggggttcgaactccggacatcccacttattca |
20610819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #254
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 144 - 181
Target Start/End: Complemental strand, 21023404 - 21023367
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
21023404 |
ggggttggggttcgaacccccgacaccccacttattca |
21023367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #255
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 135 - 196
Target Start/End: Complemental strand, 21765470 - 21765409
Alignment:
| Q |
135 |
atatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
|||| |||||||| | |||||||||| ||||||||||||||||||| |||| |||| |||| |
|
|
| T |
21765470 |
atatatgcaggggccaaggttcgaacctcggacaccccacttattcacctttgaggtaaatt |
21765409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #256
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 22751048 - 22751089
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||| ||||||| |
|
|
| T |
22751048 |
tgcaggggtcggggttcaaaccccgaacaccccatttattca |
22751089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #257
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 144 - 181
Target Start/End: Original strand, 24039927 - 24039964
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||| |
|
|
| T |
24039927 |
ggggtcggggttcgaaccccgaacacctcacttattca |
24039964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #258
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 26253991 - 26254032
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
26253991 |
tgcaggggtcggagttcgaatcccggacactccacttattca |
26254032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #259
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 27921935 - 27921980
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||| ||||||||||||||| |||| | |||||||||||||| |
|
|
| T |
27921935 |
tgcaggggccggggttcgaaccccagacatctcacttattcatctt |
27921980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #260
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 28715719 - 28715768
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
28715719 |
aatgcattttatatgcaggggccggggttcgaaccccggacactccactt |
28715768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #261
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 30203292 - 30203337
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||| || |||||||||||||||||| || ||||||||||||||| |
|
|
| T |
30203292 |
tgcagaggccggggttcgaaccccggatactccacttattcatctt |
30203337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #262
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 31601845 - 31601886
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| || | |||||||||||||||||||||||||||| |
|
|
| T |
31601845 |
tgcaggggccgagattcgaaccccggacaccccacttattca |
31601886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #263
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 181
Target Start/End: Complemental strand, 34773727 - 34773698
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
34773727 |
ggttcgaaccccggacaccccacttattca |
34773698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #264
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 181
Target Start/End: Original strand, 36576315 - 36576344
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
36576315 |
ggttcgaaccccggacaccccacttattca |
36576344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #265
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 143
Target Start/End: Original strand, 38416058 - 38416099
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgca |
143 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
38416058 |
tgagcttagctcagttggtaaggataatgcataatatatgca |
38416099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #266
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 39697928 - 39697871
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
39697928 |
tgagcttagctcagttgatagggatattgcatattatatgcaggggtcggggttcgaa |
39697871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #267
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 40666887 - 40666838
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||||||||| ||||||||||| ||||||| |||| |
|
|
| T |
40666887 |
aatgcatattatatgcaggggtcggagttcgaaccccagacaccctactt |
40666838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #268
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 154 - 220
Target Start/End: Original strand, 41943960 - 41944024
Alignment:
| Q |
154 |
ttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||| |||||||||| ||||||| ||||||||| |||| |
|
|
| T |
41943960 |
ttcgaaccccggacaccctacttattcaccttataaggtgaat---tctagccgctaggctacctgac |
41944024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #269
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 153 - 197
Target Start/End: Original strand, 44074905 - 44074950
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
||||||| ||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
44074905 |
gttcgaatcccggacaccccacttattcaccttataaggtgaattt |
44074950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #270
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 44272975 - 44273016
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
44272975 |
tgcaggggtcggagttcgaacctcggataccccacttattca |
44273016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #271
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 44602489 - 44602550
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
44602489 |
tgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaacccc |
44602550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #272
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 45029665 - 45029608
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| || | || | |||||||||| |
|
|
| T |
45029665 |
tgagcttaactcatttggtaaggacaatgcataatatatgtaaggtttggggttcgaa |
45029608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #273
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 46903332 - 46903408
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| ||| |||||| ||||| |||||| ||| ||||||||| ||| || |||||||||||||||||||| |
|
|
| T |
46903332 |
ccatgagtttagatcagttggtatggatattgcatattatatgcaggggttgggttt-gaaccccggacaccccactt |
46903408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #274
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 47416507 - 47416548
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| |||||||||| | ||||||||||||||||||| |
|
|
| T |
47416507 |
tgcaggggttggggttcgaatctcggacaccccacttattca |
47416548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #275
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 171
Target Start/End: Original strand, 48955293 - 48955362
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
||||||||||||| |||||||||| ||||| |||||| |||| | ||||||||||||| || |||||| |
|
|
| T |
48955293 |
tgagcttatctcagttggtaaggacaatgcgtaatatatgcaaagtccggggttcgaacctcgaacaccc |
48955362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #276
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 49056788 - 49056853
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| | |||||| ||| |||||| | ||| |||||||||||||||||||||||| |
|
|
| T |
49056788 |
ctcagttggtagggacattgcatattatatgcaggagccggagttcgaaccccggacaccccactt |
49056853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #277
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 49473646 - 49473707
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
|||||||| | || |||||||||| |||||||||||| |||| || ||||||||||||||| |
|
|
| T |
49473646 |
tgagcttagcccagttggtaaggacaatgcataatatatgcaaggtccggggttcgaacccc |
49473707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #278
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 185
Target Start/End: Complemental strand, 52587383 - 52587350
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
52587383 |
ggttcgaaccccggacacctcacttattcatctt |
52587350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #279
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 176
Target Start/End: Complemental strand, 53921532 - 53921499
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| |
|
|
| T |
53921532 |
aggggtcggggtttgaaccccggacaccccactt |
53921499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #280
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 54534839 - 54534904
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||| | |||||||||||||| |||||||||||||| |
|
|
| T |
54534839 |
ctcagttggtagggatattgcatattatatgcaaagttcggggttcgaaccacggacaccccactt |
54534904 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #281
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 56546505 - 56546464
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||| | ||||||||||||||||| |
|
|
| T |
56546505 |
tgcaggggccggggttcgaaccacagacaccccacttattca |
56546464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #282
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 194705 - 194669
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| |||||||||||||||||||| |||||| |
|
|
| T |
194705 |
tgcaggggttggggttcgaaccccggacactccactt |
194669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #283
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 3936628 - 3936696
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| | | |||||||||||| |||| || ||||||||||||||||| |||| |
|
|
| T |
3936628 |
tgagcttagctcagttggtatgaacaatgcataatatatgcaaggtccggggttcgaaccccggccacc |
3936696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #284
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 172
Target Start/End: Original strand, 5635228 - 5635260
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| |
|
|
| T |
5635228 |
tgcaggggtcggggttcaaaccccggacacccc |
5635260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #285
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 7230281 - 7230349
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || |||||||| |||| ||| |||| |
|
|
| T |
7230281 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcaaacctcggccacc |
7230349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #286
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 7513409 - 7513373
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
7513409 |
tgcaggggtcagggttcgaaccccggacactccactt |
7513373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #287
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 174
Target Start/End: Original strand, 9661554 - 9661626
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||| |||||||| |||||| ||||| |||||| ||| || | | ||||| ||||||||||||||||| |||| |
|
|
| T |
9661554 |
tgagtttatctcagttggtatggatattgcatattatatgtaagagtcggagttcgaaccccggacactccac |
9661626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #288
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 181
Target Start/End: Complemental strand, 10757818 - 10757790
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10757818 |
gttcgaaccccggacaccccacttattca |
10757790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #289
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 181
Target Start/End: Complemental strand, 10970989 - 10970961
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
10970989 |
gttcgaaccccggacaccccacttattca |
10970961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #290
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 164
Target Start/End: Complemental strand, 11949825 - 11949761
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||||| |||| |||||| ||| |||||||||||| |||| || |||||||| ||||||| |
|
|
| T |
11949825 |
catgagcttagctcagttggtatggacaatgcataatatatgcaaggtccggggttcaaaccccg |
11949761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #291
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 130 - 178
Target Start/End: Original strand, 12850738 - 12850786
Alignment:
| Q |
130 |
gcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
||||| ||| ||||||||||| | ||||||||| ||||||||||||||| |
|
|
| T |
12850738 |
gcatagtatatgcaggggtcgagattcgaaccctggacaccccacttat |
12850786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #292
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 180
Target Start/End: Original strand, 18497431 - 18497471
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
18497431 |
tgcaggggttggggttcgaactccggacatcccacttattc |
18497471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #293
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 19854566 - 19854634
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| | ||||||||||||| |||||||| |
|
|
| T |
19854566 |
tgagcttagctcagttggtatggacaatgcataatatatgcaagatccggggttcgaacctcggacacc |
19854634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #294
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 143
Target Start/End: Complemental strand, 22279583 - 22279539
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgca |
143 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||| |||| |
|
|
| T |
22279583 |
ccatgagcttagctcagttggtaaggacaatgcataatatatgca |
22279539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #295
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 159 - 220
Target Start/End: Original strand, 30152172 - 30152231
Alignment:
| Q |
159 |
accccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
30152172 |
accccggacaccccacttattcaccttataaggtgaat---tctagccaataggctacctgac |
30152231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #296
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 204
Target Start/End: Complemental strand, 32470440 - 32470388
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
|||||||||| |||||||| || ||||||| ||||| | |||||||||||||| |
|
|
| T |
32470440 |
ggttcgaacctcggacacctcatttattcacctttatgatgaatttctctagc |
32470388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #297
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 32690160 - 32690192
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
32690160 |
gttcgaaccccgaacaccccacttattcatctt |
32690192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #298
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 41897599 - 41897539
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||||||| |||| ||| || ||||||||||| | ||||||||||| |
|
|
| T |
41897599 |
ttggtagggatattgcataatatatgcacgggccgaggttcgaaccctgtacaccccactt |
41897539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #299
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 177
Target Start/End: Original strand, 42395604 - 42395632
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccactta |
177 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
42395604 |
cggggttcgaaccccggacaccccactta |
42395632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #300
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 131 - 199
Target Start/End: Original strand, 42488739 - 42488807
Alignment:
| Q |
131 |
cataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| || |||||| ||||||| |||| ||||| || |||||||||| ||| | ||||||||||| |
|
|
| T |
42488739 |
cataatatatgtaggggttggggttcaaacctcggacgcctcacttattcaccttaagggtgaatttct |
42488807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #301
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 43027293 - 43027361
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||||||||||||||| |||| || || |||||||| |||||||||| |
|
|
| T |
43027293 |
tgagcttagctcaattggtagtgataatgcataatatatgcaaggttcatggttcgaatcccggacacc |
43027361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #302
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 163
Target Start/End: Complemental strand, 44312849 - 44312789
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
||||||| |||| |||||| ||||| ||||| ||| ||||||||||||| |||||||||| |
|
|
| T |
44312849 |
gagcttagctcagttggtagggatattgcattttatatgcaggggtcgggattcgaacccc |
44312789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #303
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 45281953 - 45281989
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
45281953 |
tttaaggtgaatttctctaaccactaggctatttgac |
45281989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #304
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 45630498 - 45630534
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
45630498 |
tttaaggtgaatttctctaaccactaggctatttgac |
45630534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #305
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 180
Target Start/End: Complemental strand, 46735025 - 46734985
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||| ||||||||| |||| |||||||||||||||||| |
|
|
| T |
46735025 |
tgcagggatcggggttcaaacctcggacaccccacttattc |
46734985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #306
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 46799458 - 46799519
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||||||||||| ||||||| || || ||||||| |||||||||||| |||| |
|
|
| T |
46799458 |
ggttcgaaccccggacaccccatttattcactttaaaagtgaatt--tctagccactagactac |
46799519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #307
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 48950826 - 48950862
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
48950826 |
tgcaggagtcggggttcgaaccccggacactccactt |
48950862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #308
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 49264568 - 49264604
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
49264568 |
tgcaggggccgaggttcgaaccccggacaccccactt |
49264604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #309
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 50442807 - 50442740
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||||| |||| |||| ||||||||| ||| |||||| |
|
|
| T |
50442807 |
tgagcttagctcagttggtagggataatgcataatatatgca-aggtctgggttcgaatcccagacacc |
50442740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #310
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 94 - 170
Target Start/End: Original strand, 50512356 - 50512432
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| ||||||||||| |||| |||||| | ||| |||||| ||| ||||||||| | |||||||||| | |||||| |
|
|
| T |
50512356 |
aatccccatgagcttagctcagttggtaggaatattgcatattatatgcaggggttgaggttcgaacctctgacacc |
50512432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #311
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 51536901 - 51536976
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||||||||| ||| || |||||||||||||||| | |||||||| |||||||||||| |||| |||| |
|
|
| T |
51536901 |
aggggccggggttcgaacctcgggcatcccacttattcatcttatcaggtgaat---tctagccactagactacctgac |
51536976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #312
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 54304974 - 54304907
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||| ||| |||||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
54304974 |
gggttcgaatcccgaacatcccacttattcagcttataaggtgaat---tctagccactaggctacctgac |
54304907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #313
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 55536374 - 55536457
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| || |||||||| |||| |||||||||||| |||||| ||| |||||| | ||||||| ||||| |||||| |||||| |
|
|
| T |
55536374 |
tcaatccccgtgagcttagctcagttggtaaggatattgcatattatatgcaggag-cggggtttgaaccttggacactccactt |
55536457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #314
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 181
Target Start/End: Original strand, 55677149 - 55677185
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
55677149 |
gggtcggggttcgaactccggacactccacttattca |
55677185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #315
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 56497668 - 56497600
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || |||||||||| ||||| |||| |
|
|
| T |
56497668 |
tgagcttagctcaattggtaaggacaatgcataatatatgcaaggtctggggttcgaatcccggccacc |
56497600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 101; Significance: 4e-50; HSPs: 216)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 101; E-Value: 4e-50
Query Start/End: Original strand, 94 - 221
Target Start/End: Original strand, 31250139 - 31250267
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtg |
192 |
Q |
| |
|
|||| ||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31250139 |
aatccccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtg |
31250238 |
T |
 |
| Q |
193 |
aatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||| ||||||| |
|
|
| T |
31250239 |
aatttctctagccactaggctgcttgacc |
31250267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 38503355 - 38503232
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38503355 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
38503256 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| ||| |||||||||| |
|
|
| T |
38503255 |
ctctagccaatagactacttgacc |
38503232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 90; E-Value: 1e-43
Query Start/End: Original strand, 101 - 209
Target Start/End: Original strand, 43227865 - 43227974
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43227865 |
atgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
43227964 |
T |
 |
| Q |
200 |
ctagccacta |
209 |
Q |
| |
|
|||||||||| |
|
|
| T |
43227965 |
ctagccacta |
43227974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 101 - 220
Target Start/End: Original strand, 17077360 - 17077480
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| ||||||||||||||| |||||||||||||||||||||||||||||||| ||||||||||| | |
|
|
| T |
17077360 |
atgagcttagctcatttggtaagggataatgcacaatttgtgcaggggtcgggattcgaaccccggacaccccacttattcatcttaaaggtgaatttat |
17077459 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
17077460 |
ctagccactaggctacttgac |
17077480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 5039678 - 5039799
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||||||||| ||| |||||||||||| ||||||||||||||||||||||||||||| |||||| |
|
|
| T |
5039678 |
ccatgagcttaactcatttggtaaggataatgtacaatatgtgcaagggccggggttcgaacttcggacaccccacttattcatctttaaggtaaatttc |
5039777 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
5039778 |
tctagccactagactacttgac |
5039799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 4395949 - 4395827
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||| || ||||||||||||| |||||||||| ||| ||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4395949 |
ccatgagcttaactcatttggcaaatgataatgcataatgtgtgcaggggccggagttcgaacccctgacaccccatttattcatctttaaggtgaattt |
4395850 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| ||||||| ||||| |
|
|
| T |
4395849 |
ctctagccaataggctatttgac |
4395827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 33545459 - 33545362
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| ||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
33545459 |
ggataatgcacaatatgtgcaggggtcggagtttgaacctcggacacccc-cttattcatctttaaggtgaatttctctagccactaggctacttgacc |
33545362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 42208914 - 42209035
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||| |||||| ||||| || ||||||||||||| || ||||||||| ||||||||| |||||||||||||||||||||||||| |
|
|
| T |
42208914 |
ccatgagcttagctcatttagtaagggataatacacaatatgtgcagggc-cgaggttcgaactccggacacctcacttattcatctttaaggtgaattt |
42209012 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||||||||||||| |
|
|
| T |
42209013 |
ctctagtcactaggctacttgac |
42209035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 12375510 - 12375383
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
12375510 |
ccatgagcttagctcatttggtaatggataatgcacaatatgtgcaggggccggggttcgaaccccgggcacggacacctcacttattcat-tttaaggt |
12375412 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
12375411 |
gaatttctctagccactaggctatttgac |
12375383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 20191442 - 20191560
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||| ||| |||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||| |
|
|
| T |
20191442 |
tgagcttaactcacttggtaagggataatgcatt-tatatgcaggggtcggggttcgaaccccggacactccacttattcacctttaaggtaaatttctc |
20191540 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
| |||||||| ||||||||| |
|
|
| T |
20191541 |
tggccactagactacttgac |
20191560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 15106985 - 15106864
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||| |||||| || ||||||||||| |||||||| ||| ||||||| ||||||||||||||||||||||||||||||||||||||||||| | ||||| |
|
|
| T |
15106985 |
ccattagcttaacttatttggtaagggataatgcacaatttgtgcagaggtcggggttcgaaccccggacaccccacttattcatctttaaaataaattt |
15106886 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
||||| |||||| |||||||| |
|
|
| T |
15106885 |
ctctaaccactaaactacttga |
15106864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 15470717 - 15470597
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| |||||||||| ||| | | |||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
15470717 |
atgagcttaattcatttggtaagggataatgcacaatatgtgcaagggctgagattcgaaccccagacaccccatttattcatctttaaggtgaatttct |
15470618 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
15470617 |
ctagccactaaactacttgac |
15470597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 931036 - 930913
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||||| || |||||| ||||||| | |||||| ||||||||||||||| |||||||||||| | |||| |||||||||||||||| ||||||||||| |
|
|
| T |
931036 |
ccatgagcatagctcattcggtaagggacaatgcacaatatgtgcaggggttggggttcgaacctcagacatcccacttattcatcttaaaggtgaattt |
930937 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| ||||| |||||||||| |
|
|
| T |
930936 |
ctctagtcactaaactacttgacc |
930913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 138 - 219
Target Start/End: Original strand, 1572147 - 1572228
Alignment:
| Q |
138 |
tgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||||||||||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
1572147 |
tgtgcaggggctggggttcgaaccccggactccccacttattcatcttaaaggtgaatttctctagccactagactacttga |
1572228 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 5263171 - 5263288
Alignment:
| Q |
104 |
agcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||| |||||||||||| |||||||||| |||||||| ||||| | |||||||||| |||||| || ||||||||||||||| |||||||||||| |
|
|
| T |
5263171 |
agcttagctcatttggtaatggataatgcacaatatgtgtagggggtgatgttcgaacccgagacaccacatttattcatctttaagctgaatttctcta |
5263270 |
T |
 |
| Q |
203 |
gccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
5263271 |
gccactaggctacttgac |
5263288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 110 - 202
Target Start/End: Original strand, 34729480 - 34729572
Alignment:
| Q |
110 |
tctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
||||| ||||||||| |||||||||| ||| ||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
34729480 |
tctcacttggtaagggataatgcatattatatgcaggggtcggggttcgaaccc-ggacaccccacttattcacctttaaggtgaatttctcta |
34729572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 106 - 220
Target Start/End: Complemental strand, 15680992 - 15680877
Alignment:
| Q |
106 |
cttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||||| ||| | |||| |||||||| ||||||||||||||||||| |||||||||||||||||||| | |
|
|
| T |
15680992 |
cttagctcacttggtaaggaataatgcataatatatgcggtggtcaaaattcgaacctcggacaccccacttattcacctttaaggtgaatttctctaac |
15680893 |
T |
 |
| Q |
205 |
cactaggctacttgac |
220 |
Q |
| |
|
| |||||||||||||| |
|
|
| T |
15680892 |
cgctaggctacttgac |
15680877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 9628117 - 9628235
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||| |||||| |||||||||||||| | ||||||| | ||||||| |||||||||||| |||| |
|
|
| T |
9628117 |
tgagcttaactcatttggtaagagataatgcataatatatgcaggattcggggttcgaacctcagacaccctatttattcacctttaaggtgaaattctt |
9628216 |
T |
 |
| Q |
201 |
tagccactaggctacttga |
219 |
Q |
| |
|
||| | |||||||||||| |
|
|
| T |
9628217 |
tagtcgataggctacttga |
9628235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 3294105 - 3294202
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||| | |||||||| ||||||||||| ||||||| |||| ||||||||||||||||||||||||| ||| | |||| ||||||||| |
|
|
| T |
3294105 |
ggataatgcataatttatgcaggggccggggttcgaattccggacaacccatttattcatctttaaggtgaatttctatagtcgctagactacttgac |
3294202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 113 - 221
Target Start/End: Original strand, 41836051 - 41836159
Alignment:
| Q |
113 |
catttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactagg |
211 |
Q |
| |
|
||||||||||||| | | ||||||||||||||||||||||||||||||| |||||| ||| |||||||||||||||||||||||||| | ||||| | |
|
|
| T |
41836051 |
catttggtaaggaatgaagcataatatgtgcaggggtcggggttcgaacttcggacattccatttattcatctttaaggtgaatttctc-aaccactgga |
41836149 |
T |
 |
| Q |
212 |
ctacttgacc |
221 |
Q |
| |
|
|||||||||| |
|
|
| T |
41836150 |
ctacttgacc |
41836159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 100 - 217
Target Start/End: Complemental strand, 1984286 - 1984168
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| | | |||||||| | ||||||||| |||| |||||||||||||||| |||||||||| |
|
|
| T |
1984286 |
catgagcttaactcatttggtaagggataatgcacaattttcgtaggggtcgagtttcgaaccctagacatcccacttattcatcttaaaggtgaattct |
1984187 |
T |
 |
| Q |
199 |
tctagccactaggctactt |
217 |
Q |
| |
|
||||||||||||| ||||| |
|
|
| T |
1984186 |
tctagccactaggttactt |
1984168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 15696205 - 15696330
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc-----cggacaccccacttattcatctttaaggtga |
193 |
Q |
| |
|
|||||| ||| |||||||| ||||| |||||||| |||||||| ||||| |||| ||||| ||| |||||||| ||||||||||| |||||||||| |
|
|
| T |
15696205 |
catgagtttagctcatttgataagggataatgcacaatatgtgtaggggccgggattcgaccccgggcacggacacctcacttattcat-tttaaggtga |
15696303 |
T |
 |
| Q |
194 |
atttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| ||||| |
|
|
| T |
15696304 |
atttctctagccactaggctatttgac |
15696330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 8241051 - 8241128
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| |||||| ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
8241051 |
ccatgagcttagctcagttggtagggatattgcatattatatgcaagggtcggggttcgaaccccggacaccccactt |
8241128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 121 - 217
Target Start/End: Original strand, 29530794 - 29530888
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||| ||| |||||||||| |||||||||||||||||||||| || |||| ||||| | ||||||||||| || |||||||||||||| |
|
|
| T |
29530794 |
aaggataatgcacaatttgtgcaggggccggggttcgaaccccggacaccacatttat--atcttaatggtgaatttctttacccactaggctactt |
29530888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 99 - 198
Target Start/End: Original strand, 87788 - 87888
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| ||||| |||| ||||||| |||||||| || ||||||||| ||||||| |||||||||||||| |
|
|
| T |
87788 |
ccatgagctcaactcatttggtaagggataatgcacaatatatgcaagggtcggagttcgaactccagacaccccaactattcatttttaaggtgaattt |
87887 |
T |
 |
| Q |
198 |
c |
198 |
Q |
| |
|
| |
|
|
| T |
87888 |
c |
87888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 129 - 221
Target Start/End: Original strand, 18175235 - 18175327
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta--aggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| ||| || ||||||||||||||||||||| |||| |||||||||||||||||| ||||||||| |||||||||||||||||| |||| |
|
|
| T |
18175235 |
tgcatattatatgtaggggtcggggttcgaaccccagacatcccacttattcatctttatgaggtgaatt--tctagccactaggctactagacc |
18175327 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 18872560 - 18872637
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| | ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
18872560 |
tgcaggggtcggggttcgaaccccgaacaccccacttattca-ccttaaggtgaat---tctagccactaggctacctgacc |
18872637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 32158508 - 32158392
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttct |
199 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||| || || |||||||| |||||||||||||||| |||||||||||||||| ||| |||||||||| | |
|
|
| T |
32158508 |
tgagcttagctcaattggta-ggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataaggtgaat---t |
32158413 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||| |||| |
|
|
| T |
32158412 |
ctagccactaggctacctgac |
32158392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 4674871 - 4674812
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
4674871 |
tgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
4674812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 23925582 - 23925660
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||||||||| |||||| |||||||||||||||||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
23925582 |
tgcaggggtctgggttcgaatcccggataccccacttattcatcttataaggtgaat---tctagccactagactacttgac |
23925660 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 149 - 219
Target Start/End: Complemental strand, 29413610 - 29413539
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||| |||||||||||||||| ||||||| |||||||| |
|
|
| T |
29413610 |
cggggttcaaaccccgaacaccccacttattcatcttaaaaggtgaatttctctaaccactagactacttga |
29413539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 36045190 - 36045131
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
36045190 |
tgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
36045131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 6558805 - 6558879
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||| |||||||||| |||| |
|
|
| T |
6558805 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggtcggggttcgaactccggacaccctactt |
6558879 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 11897252 - 11897326
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11897252 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
11897326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 12891561 - 12891635
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
12891561 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccactt |
12891635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 13622012 - 13621938
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
13622012 |
tgagcttagctcagttggtagggatatcgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
13621938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17545238 - 17545164
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
17545238 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
17545164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 145 - 220
Target Start/End: Original strand, 29331287 - 29331360
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
29331287 |
gggtcggggttcgaaccccgaacactccacttattcatcttataaggtgaat---tctagccactaggctacctgac |
29331360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 124 - 185
Target Start/End: Complemental strand, 42801514 - 42801452
Alignment:
| Q |
124 |
gataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||| || || ||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42801514 |
gataatgcattattatatgcaggggtcggggttcgaaccccggacacctcacttattcatctt |
42801452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 134 - 220
Target Start/End: Complemental strand, 42902126 - 42902041
Alignment:
| Q |
134 |
aatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| || | ||||||||||| |||| || ||||||||||||||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
42902126 |
aatatgtgcaggagttagagttcgaacccctgacaacc-acttattcatctttaaggtaaatttctctagccactaaactacttgac |
42902041 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 1463910 - 1463988
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||| ||||||| |||| |
|
|
| T |
1463910 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccaccaggctacctgac |
1463988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 214
Target Start/End: Complemental strand, 2029184 - 2029112
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
2029184 |
tgcaggggtcgggattcgaaccccgaacaccccacttattcaccttataaggtgaat---tctagccactaggcta |
2029112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 8015874 - 8015931
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8015874 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
8015931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 102 - 218
Target Start/End: Complemental strand, 12256582 - 12256474
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| |||||| | ||||||||||||||| |||||||||||||||||||| || | ||||||| |||||||||||||||||| |
|
|
| T |
12256582 |
tgagcttagctcacttggtatgagataatgcataatatatgcaggggtcggggttcgaatcct---------atttattcacctttaaggtgaatttctc |
12256492 |
T |
 |
| Q |
201 |
tagccactaggctacttg |
218 |
Q |
| |
|
||||| |||||||||||| |
|
|
| T |
12256491 |
tagccgctaggctacttg |
12256474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 26671605 - 26671701
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa-ggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||| ||| |||||||||| | | |||||| || | |||||||||||||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
26671605 |
ggataatgcacaatttgtgcaggggctgagtttcgaatccag-acaccccacttattcatcttaaaaggtgaatttctctagccactagactacttga |
26671701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 26943202 - 26943298
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa-ggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||| ||| |||||||||| | | |||||| || | |||||||||||||||||||| || |||||||||||||||||||||| |||||||| |
|
|
| T |
26943202 |
ggataatgcacaatttgtgcaggggctgagtttcgaatccag-acaccccacttattcatcttaaaaggtgaatttctctagccactagactacttga |
26943298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 37303973 - 37304050
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||| |||||| |||||| | ||||||||||||||| |||| |
|
|
| T |
37303973 |
tgcaggggtcggggttcgaaccctggacaccccacttattca-ctttaaaatgaatt--tatagccactaggctacctgac |
37304050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 39405309 - 39405427
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggaca-ccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
||||||| ||| |||||||||||||| ||||||||||| ||||| ||||||||||||| ||| ||| |||| ||||| ||||||||| ||||||| |
|
|
| T |
39405309 |
ccatgaggttacctcatttggtaagggataatgcataacatgtgtaggggtcggggtttgaatcccagacacccccatttattcatc------gtgaatt |
39405402 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| | |||||||||| |
|
|
| T |
39405403 |
tctctagccacaaaactacttgacc |
39405427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 1244783 - 1244704
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||| ||| |||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
1244783 |
tgcaggggtcagggttcgaaccccagacaccccacttattcaccttataaggtgaat---tctagccactaggttacctgacc |
1244704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 35168676 - 35168632
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
35168676 |
ggttcgaaccccggacaccccacttattcacctttaaggtgaatt |
35168632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 36226191 - 36226112
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||||||||||||||||||| ||| ||||||||||| |||||||||| | ||||||||||||||| ||||| |
|
|
| T |
36226191 |
tgcagaggtcggggttcgaaccccggacactccatttattcatcttataaggtgaat---tatagccactaggctacctgacc |
36226112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 546806 - 546885
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||||||||||||||||| || ||| ||||||| |||| |
|
|
| T |
546806 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcgaacatcccacttcttca |
546885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 121 - 220
Target Start/End: Complemental strand, 3867828 - 3867730
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| |||| ||||| |||||||||||||||||||| | | |||||||||||||| || ||||| ||||||||||| |||||| |||||||||| |
|
|
| T |
3867828 |
aaggatattgcaaaatatatgcaggggtcggggttcgaatctcaaacaccccacttatttat-tttaaagtgaatttctccgaccactaagctacttgac |
3867730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 19059060 - 19058982
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||||||||| ||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
19059060 |
tgcaggggccggggttcgaaccctggacaccccacttattcaccttataaggtgaat---tctagccactagcctacctgac |
19058982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 20735228 - 20735152
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
20735228 |
aggggccggggttcgaatcccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
20735152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 29096364 - 29096286
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||| ||| ||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
29096364 |
tgcaagggccggagttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgac |
29096286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 150 - 221
Target Start/End: Original strand, 42355722 - 42355793
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatcttta--aggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| ||||| ||||||||| |||||||| |||||||||||||| |
|
|
| T |
42355722 |
ggggtttgaaccccggacaccccacttattcacctttaagaggtgaatt--tctagccattaggctacttgacc |
42355793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3198331 - 3198405
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||||| ||||||||| | |||||||||||||||||||| |||| |
|
|
| T |
3198331 |
tgagcttagctcagttggtagggacattgcataatatatgcaggggttgaggttcgaaccccggacaccctactt |
3198405 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 4067986 - 4068060
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||| | | |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
4067986 |
tgagcttagctcagttggtagggacaatgcatattttatgcagggggcgaggttcgaaccccggacaccccactt |
4068060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4417751 - 4417677
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
4417751 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
4417677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 8968753 - 8968827
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
8968753 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
8968827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 9835037 - 9835111
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
9835037 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
9835111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 12463760 - 12463834
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
12463760 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
12463834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 14641175 - 14641101
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
14641175 |
tgagcttaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
14641101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 15241400 - 15241474
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || | ||| |||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
15241400 |
tgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaacctcggacaccccactt |
15241474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 18928724 - 18928798
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||||| | |||||||||||| ||||||||| |||||||| ||||| |
|
|
| T |
18928724 |
tgagcttagctcagttggtagggatattgcataatttatgcaggggtcggtgttcgaaccacggacacctcactt |
18928798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 32505692 - 32505766
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
32505692 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
32505766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 36888461 - 36888387
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
36888461 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
36888387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 38618737 - 38618664
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| ||| |||||||||| |||||| |||||||||| |
|
|
| T |
38618737 |
tgcaagggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagcaactaggctac |
38618664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 42455450 - 42455377
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||| ||||||||||||||||| ||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
42455450 |
tgcaggggccggagttcgaaccccggacactccacttattcaccttataaggtgaat---tctagccactaggctac |
42455377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42916393 - 42916467
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || || ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
42916393 |
tgagcttagctcagttggtagggatattgtatgttatatgcaggggccggggttcgaaccccggacaccccactt |
42916467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 198
Target Start/End: Original strand, 43263210 - 43263303
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||| || |||| ||||||||| ||||| |||||||||| |||||||||||||| |||||||| |
|
|
| T |
43263210 |
ccatgagcttaactcatttggtaagagataatgcacaacatgtacaggggtcg-------aaccctggacaccccagttattcatctttaaagtgaattt |
43263302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 125 - 197
Target Start/End: Original strand, 962312 - 962387
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat---tcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||| ||| ||||||||| ||||||||||| |||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
962312 |
ataatgcatgttatatgcaggggttggggttcgaactccggacaccctacttattcatcatctttaaggtgaattt |
962387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 122 - 215
Target Start/End: Original strand, 6014799 - 6014891
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||| || || || |||| |||||||| |||| ||||||||| |||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
6014799 |
aggataatgcattattatatgtagggatcggggtttgaactccggacacctcacttattcatcttataaggtgaat---tctagccactaggctac |
6014891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 6614094 - 6614049
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
6614094 |
tgcaggggccggggttcgaacctcggacaccccacttattcatctt |
6614049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 10943755 - 10943796
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10943755 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
10943796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 116 - 181
Target Start/End: Original strand, 15715800 - 15715865
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| ||| |||||||||||| ||||||||||| ||||||||||||||| |||| |||| |||| |
|
|
| T |
15715800 |
ttggtagggacaatgcataatatatgcaggggtcgaggttcgaaccccggataccctacttcttca |
15715865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 24033082 - 24033155
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||||| ||||| ||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
24033082 |
gagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacacgccactt |
24033155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 31556857 - 31556898
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
31556857 |
tgcaggggtcggagttcgaaccccggacaccccacttattca |
31556898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 843421 - 843346
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||| ||| ||||| ||||||||||||||||| |||| |
|
|
| T |
843421 |
aggggacggggttcgaaccccggacaccccacttattcaccttataaattgaat---tctagccactaggctacctgac |
843346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 3740996 - 3741032
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3740996 |
tgcaggggtcggggttcgaaccccggacaccccactt |
3741032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 11935196 - 11935244
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
11935196 |
cacttattcgtctttaaggtaaatttctctagtcactaggctacttgac |
11935244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 217
Target Start/End: Complemental strand, 15254253 - 15254134
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca-tctttaaggtgaatt |
196 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||| ||||| || |||||| | |||||| |||| ||| |||||||||||| | |||||||| |||| |
|
|
| T |
15254253 |
ccatgagcttagctcatttgttaagagataatgcacaatatatgtaggggttaga-ttcgaatcccgaacatcccacttattcattttttaaggtaaatt |
15254155 |
T |
 |
| Q |
197 |
tctctagccactaggctactt |
217 |
Q |
| |
|
|||| ||||||||| |||||| |
|
|
| T |
15254154 |
tctcaagccactagactactt |
15254134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 22498943 - 22499010
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| |||| |||||||||||||||||||| |
|
|
| T |
22498943 |
tgagcttaactcagttggtaaggacaatgcataatatatgca-aggtctgggttcgaaccccggacacc |
22499010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 27679499 - 27679567
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||||||| |||| || ||||||||| || |||||||||| |
|
|
| T |
27679499 |
tgagcttagctcagttggtaaagataatgcataatatatgcaaggttcggggttcaaatcccggacacc |
27679567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 152 - 208
Target Start/End: Complemental strand, 27691322 - 27691266
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccact |
208 |
Q |
| |
|
|||||||| |||||||||| || |||| |||||||||||||||||| |||||||||| |
|
|
| T |
27691322 |
ggttcgaatcccggacacctcatttatccatctttaaggtgaatttatctagccact |
27691266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 6806696 - 6806618
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||||||||||| || |||||||||| |||||||| |||||||| |||| |
|
|
| T |
6806696 |
tgcaggggtcgggattcgaaccccggacactccacttattcacattataaggtgaat---tctagccattaggctacctgac |
6806618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 18478046 - 18478120
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| |||||||||||||| |||||||||||||||||| ||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
18478046 |
ggggccggggttcgaaccctggacaccccacttattcaccttataaggtgaat---tctagccattaggctacctgac |
18478120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 150 - 185
Target Start/End: Complemental strand, 22397034 - 22396999
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
22397034 |
ggggttcgaaccccggacaccccacttattcatctt |
22396999 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 101 - 219
Target Start/End: Complemental strand, 26211053 - 26210934
Alignment:
| Q |
101 |
atgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| |||| ||| ||||| |||| ||||||||| | |||||||| ||||||| ||| |||||||||||| |
|
|
| T |
26211053 |
atgagcttagctcagttggtaatggataattcatattatatgcagaagtcgtggttcgaactctggacaccctacttattttcatttgaggtgaatttct |
26210954 |
T |
 |
| Q |
200 |
ctagccactaggctacttga |
219 |
Q |
| |
|
||| ||| ||| |||||||| |
|
|
| T |
26210953 |
ctaaccaatagactacttga |
26210934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 28537174 - 28537254
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa---ggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||||||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
28537174 |
tgcatgggccggggttcgaaccccggacaccccacttattcactttgaaaatggtgaat---tctagccactaggctacttgac |
28537254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 176
Target Start/End: Complemental strand, 32226284 - 32226237
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
32226284 |
tgcatattatatgcaggggtcggggttcgaacctcggacaccccactt |
32226237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 103 - 162
Target Start/End: Complemental strand, 33736079 - 33736020
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
33736079 |
gagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
33736020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 35515516 - 35515583
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
35515516 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacac |
35515583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4745942 - 4745868
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||| | ||||||||||||||||||||| |||||| |
|
|
| T |
4745942 |
tgagcttagctcagttggtagggatattgcatattatatgaaggagccggggttcgaaccccggacactccactt |
4745868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 185
Target Start/End: Original strand, 4985801 - 4985843
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||| |
|
|
| T |
4985801 |
aggggtcggggttcgaaccctggacaccctacttattcatctt |
4985843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 170 - 220
Target Start/End: Original strand, 5048701 - 5048751
Alignment:
| Q |
170 |
cccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||||||||||||||||||| |||||||||| || |||||| |
|
|
| T |
5048701 |
cccacttatttatctttaaggtgaatttctttagccactagactgcttgac |
5048751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 5966833 - 5966907
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
5966833 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
5966907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 6518842 - 6518768
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
6518842 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactt |
6518768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17064924 - 17064850
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| || ||| |||||||||||||||||||| |
|
|
| T |
17064924 |
tgagcttaactcaattggtagggatattgcatattatatgcaggggccgacgtttgaaccccggacaccccactt |
17064850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 18303131 - 18303056
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| || || ||||||| |||||||||||| |||| |||| |
|
|
| T |
18303131 |
aggggttggggttcgaaccccgaacaccccacttattcactttaaaagtgaatt--tctagccactagactacctgac |
18303056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19891492 - 19891418
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| ||||| ||| ||||||||| |||||||||| |||||| || |||||| |
|
|
| T |
19891492 |
tgagcttaactcagttggtaaggatattgcattttatatgcaggggttggggttcgaatcccggatactccactt |
19891418 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 127 - 169
Target Start/End: Original strand, 20224134 - 20224176
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||| |
|
|
| T |
20224134 |
aatgcataatatatgcaggggtcagggttcgaaccccggacac |
20224176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 23292483 - 23292409
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| ||||||| | |||||||||||| |||||||||||||| |
|
|
| T |
23292483 |
tgagcttagctcagttggtagggatattgcatgttatatgcagggtttggggttcgaacctcggacaccccactt |
23292409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 25400433 - 25400359
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
25400433 |
tgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
25400359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 25729506 - 25729432
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
25729506 |
tgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaaccccagacactccactt |
25729432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 27765261 - 27765335
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
27765261 |
tgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
27765335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 139 - 185
Target Start/End: Original strand, 29561686 - 29561732
Alignment:
| Q |
139 |
gtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||| ||||||||||||||| |||| |||||||||||||||| |
|
|
| T |
29561686 |
gtgcaggggccggggttcgaaccccagacatcccacttattcatctt |
29561732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 31991856 - 31991798
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
31991856 |
tgagcttagctcacttggtaagggataatgcattatatatgcaggggtcggggttcgaa |
31991798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 193
Target Start/End: Original strand, 33800932 - 33800986
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtga |
193 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||| ||| |||||||| |
|
|
| T |
33800932 |
tgcaggggccggggttcgaaccccagacaccccacttattcaccttataaggtga |
33800986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 36124403 - 36124477
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || | ||| |||||| ||| |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
36124403 |
tgagcttagctcagttgataggaatattgcatattatatgcaggggtcggggttcgaatcccggacactccactt |
36124477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 39800096 - 39800022
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||| | |||||||| |||| ||||||||| |||||||||||| |
|
|
| T |
39800096 |
tgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggctcgaacccctgacaccccactt |
39800022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 41179869 - 41179795
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||||||||| |||||| |
|
|
| T |
41179869 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccactt |
41179795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42320321 - 42320395
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||| |||||||||||| |||| |||||| |
|
|
| T |
42320321 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggagttcgaaccccgaacactccactt |
42320395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42525404 - 42525478
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
42525404 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
42525478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 2362973 - 2363034
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||| |||||||||||||| |
|
|
| T |
2362973 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggttggggttcgaacccc |
2363034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 2411350 - 2411305
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
2411350 |
tgcaggggccggagttcgaaccccagacaccccacttattcatctt |
2411305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 6447536 - 6447495
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
6447536 |
tgcaggggccggggttcgaacctcggacaccccacttattca |
6447495 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 146 - 220
Target Start/End: Complemental strand, 7234922 - 7234850
Alignment:
| Q |
146 |
ggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||| || |||||| ||||||| ||| |||||||||| |||||||||||| ||||||||| |
|
|
| T |
7234922 |
ggtcggggttcgaaccccagataccccatttattcaccttataaggtgaat---tctagccactagtctacttgac |
7234850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 104 - 169
Target Start/End: Original strand, 10404133 - 10404198
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||| |||| |||||| | ||| |||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
10404133 |
agcttagctcagttggtaggaatattgcatattatatgcaggagtcggggttcgaaccccggacac |
10404198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 172 - 221
Target Start/End: Original strand, 16965816 - 16965865
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||||||||||| ||| |||||||||| |
|
|
| T |
16965816 |
cacttatttatctttaatgtgaatttctctagccattagactacttgacc |
16965865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 17175120 - 17175043
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||| |||||| ||||| ||||| ||| |||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
17175120 |
ccatgagtttaactcagttggtagggatattgcatgttatatgcaggggccggggttcgaacctcggacactccactt |
17175043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 17891900 - 17891851
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
17891900 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
17891851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 18638603 - 18638676
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||||| ||||| |||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
18638603 |
gagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccactt |
18638676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 20145633 - 20145556
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| || | |||||| ||||| |||||||| | |||| ||| ||||||||||||| |||||||||||||| |
|
|
| T |
20145633 |
ccatgaacttagcttagttggtagggatattgcataatttatgcaagggccggggttcgaacctcggacaccccactt |
20145556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 20945947 - 20945890
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
20945947 |
tgcaggggccggggttcgaaatccggacaccccacttattcaccttataaggtgaatt |
20945890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 153 - 197
Target Start/End: Complemental strand, 26302537 - 26302492
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
||||||||| ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
26302537 |
gttcgaacctcggacaccccacttattcatcttataaggtgaattt |
26302492 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 38129069 - 38129028
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
38129069 |
tgcaggggtcggggttcgaaccctggacactccacttattca |
38129028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Complemental strand, 40361645 - 40361572
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
40361645 |
tgagtttagctcagttggtagggatattgcatattatatgcaagggttggggttcgaactccggacaccccact |
40361572 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 3497438 - 3497474
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
3497438 |
tgcaggggtcggggttcgaaccctggacaccccactt |
3497474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 3535983 - 3535951
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
3535983 |
cggggttcgaaccccggacaccccacttattca |
3535951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 172
Target Start/End: Complemental strand, 4238360 - 4238304
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||| ||||||||||||||||||| |||| |
|
|
| T |
4238360 |
ttggtatggatattgcatattatatgcaggggccggggttcgaaccccggacgcccc |
4238304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 10106682 - 10106714
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
10106682 |
gttcgaaccccggacaccccacttattcatctt |
10106714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Original strand, 13958408 - 13958460
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
13958408 |
gatattgcatattatatgcaggggacggggttcgaaccccggacactccactt |
13958460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 166
Target Start/End: Original strand, 17666010 - 17666074
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
|||||||| |||| |||||| | ||| |||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
17666010 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggggtcagggttcgaaccccgga |
17666074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 18050221 - 18050257
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| |
|
|
| T |
18050221 |
tgcaggggtcggggttcgaaccccggacactccactt |
18050257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 18202146 - 18202071
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||| || |||||||| ||||||||| ||| |||||||||| | ||||||||||||||| |||| |
|
|
| T |
18202146 |
aggggtcggggttcgaatcctggacacccaacttattcaccttataaggtgaat---tatagccactaggctacctgac |
18202071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 113 - 169
Target Start/End: Complemental strand, 20707842 - 20707786
Alignment:
| Q |
113 |
catttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||||||| ||||| |||||| ||| ||||||||| |||||||||||||| ||||| |
|
|
| T |
20707842 |
catttggtagggatattgcatactatatgcaggggttggggttcgaaccccagacac |
20707786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 175
Target Start/End: Complemental strand, 23937974 - 23937926
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23937974 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccact |
23937926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 25346223 - 25346296
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||| |||||| || || ||||||| ||||||||||| ||||| |
|
|
| T |
25346223 |
tgcaggggccggggttcgaatcccggacaccccacgtattcactttaaaagtgaatt--tctagccactaagctac |
25346296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 36037605 - 36037569
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
36037605 |
tttaaggtgaatttctctagccactaggctatttgac |
36037569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 196
Target Start/End: Complemental strand, 36888187 - 36888092
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||||||| |||||| ||| ||||||| || || |||||||| ||||||| ||| || ||| |||||||||||||||||| ||||||||||| |
|
|
| T |
36888187 |
tgagcatatctcagttggta-ggacaatgcattattatatgcaggggccggggttggaatcctggagaccccacttattcatcttataaggtgaatt |
36888092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 39234767 - 39234731
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
39234767 |
tgcaggggtcgggattcgaaccccggacaccccactt |
39234731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 39919159 - 39919087
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||| |
|
|
| T |
39919159 |
tgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
39919087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 41319503 - 41319443
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| ||||| ||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
41319503 |
ttggtagggatattgcattttatatgcaggggtcggagttcgaaccccggacactccactt |
41319443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #146
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 2328587 - 2328670
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| || | |||||| ||||| |||||| ||| |||||| | ||||||||||||||| ||||| |||||| |
|
|
| T |
2328587 |
caatccccgtgagcttagcttagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccactt |
2328670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #147
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 8571824 - 8571871
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| |||||| |||| |
|
|
| T |
8571824 |
tgcataatttatgcaggggtcggggttcgaaccccgaacaccctactt |
8571871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #148
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 16263777 - 16263857
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa-ggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||| ||||||||| ||||||||||||| ||| || |||||||| ||||||||||| |||| |||||| |
|
|
| T |
16263777 |
tgcaggggccggggttctaaccccggattccccacttattcaccttaaagggtgaatt--tctagccactacgctaattgacc |
16263857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #149
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 101 - 176
Target Start/End: Complemental strand, 16386808 - 16386733
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||| || |||||| |
|
|
| T |
16386808 |
atgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggatactccactt |
16386733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #150
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 196
Target Start/End: Original strand, 20762330 - 20762377
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||| |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
20762330 |
ggggttcgaaccctggacaccccacttattcaccttataaggtgaatt |
20762377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #151
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 26912828 - 26912911
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| || ||||| ||||||||||||||| |||||| |||| |
|
|
| T |
26912828 |
caatccccgtgagcttaactcaattggtagggatattgcatattatatgtaggggccggggttcgaaccccaaacaccctactt |
26912911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #152
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 196
Target Start/End: Original strand, 30403791 - 30403846
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||| ||| ||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
30403791 |
caggggccggagtttgaaccccggacaccccacttattcaccttataaggtgaatt |
30403846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #153
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 152 - 199
Target Start/End: Original strand, 38435970 - 38436017
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||| | ||||||| ||||||||| ||||||||||||||||| |
|
|
| T |
38435970 |
ggttcgaaccacagacaccctacttattcacctttaaggtgaatttct |
38436017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #154
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 181
Target Start/End: Complemental strand, 42618467 - 42618428
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||| |||||| |||||||||||||| |
|
|
| T |
42618467 |
caggggtcggggttcgaatcccggataccccacttattca |
42618428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #155
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 111 - 161
Target Start/End: Complemental strand, 42643889 - 42643838
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaacc |
161 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||| ||||||||| |
|
|
| T |
42643889 |
ctcatttggtaagggataatgcacaatatgtgcaggggtcgaagttcgaacc |
42643838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #156
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 1743131 - 1743204
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||| |||||||||||||||| |||||| |
|
|
| T |
1743131 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggg-ttcgaaccccggacactccactt |
1743204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #157
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 219
Target Start/End: Original strand, 5891096 - 5891170
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||| ||||||||||| ||||||||||||| ||||| ||| | |||||||||||||||| |||| ||||||| |
|
|
| T |
5891096 |
gggttggggttcgaacttcggacaccccactcattcaccttcatagtgaatttctctagcctctagagtacttga |
5891170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #158
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 5900296 - 5900361
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||| ||||||||||||||| |
|
|
| T |
5900296 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggccggg-ttcgaaccccggaca |
5900361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #159
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 146 - 188
Target Start/End: Original strand, 8934826 - 8934868
Alignment:
| Q |
146 |
ggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
||||||||||||| ||||||| |||||||||||||| |||||| |
|
|
| T |
8934826 |
ggtcggggttcgagccccggataccccacttattcacctttaa |
8934868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #160
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 9125667 - 9125740
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| ||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
9125667 |
tgagcttagctcagttggtagcgatattgcatattatatgcagggc-cggggttcgaaccccggacacctcactt |
9125740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #161
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 11146595 - 11146521
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| |||||||| ||||| ||| || |||||| || ||||||||||||||||| |||||| |
|
|
| T |
11146595 |
tgagcttagctcagttgataaggatattgcatgttatatgtaggggttggagttcgaaccccggacactccactt |
11146521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #162
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 11637632 - 11637570
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||||| || |||| || ||||||||||||||||| |
|
|
| T |
11637632 |
tgagcttaactcagttggtatggacaatgcataaaatatgcaaggttcggggttcgaaccccg |
11637570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #163
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 11774521 - 11774451
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| || ||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
11774521 |
cttagctcagtttgtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
11774451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #164
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 131 - 181
Target Start/End: Complemental strand, 16720643 - 16720593
Alignment:
| Q |
131 |
cataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| ||| ||||||||||||||||| ||| ||||||||||||||| |||| |
|
|
| T |
16720643 |
catattatatgcaggggtcggggttcaaacaccggacaccccacttcttca |
16720593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #165
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 21918056 - 21918130
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||| |||||| |||||| |
|
|
| T |
21918056 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccctggacactccactt |
21918130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #166
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 22229028 - 22228954
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| ||||| ||| |||||||||||| |||||||| |||||||| |||||| |
|
|
| T |
22229028 |
tgagtttagctcagttggtatggatattgcatgttatatgcaggggtcggagttcgaactccggacactccactt |
22228954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #167
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 171
Target Start/End: Original strand, 24456220 - 24456262
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
|||||||| | |||||||||||| ||||||||||||||||||| |
|
|
| T |
24456220 |
tgcataatttatgcaggggtcggagttcgaaccccggacaccc |
24456262 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 199
Target Start/End: Complemental strand, 25830811 - 25830710
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta--aggtgaattt |
197 |
Q |
| |
|
|||||||||| |||| |||| ||||| |||||| ||| |||||||| || | ||||||||| | |||| ||| ||||||||||||| |||||||||| |
|
|
| T |
25830811 |
catgagcttagctcaattggcaaggacgttgcatattatatgcaggggccgagattcgaaccctgaacactccatttattcatctttatgaggtgaattt |
25830712 |
T |
 |
| Q |
198 |
ct |
199 |
Q |
| |
|
|| |
|
|
| T |
25830711 |
ct |
25830710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #169
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 127 - 169
Target Start/End: Original strand, 26902651 - 26902692
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||||||||||| |
|
|
| T |
26902651 |
aatgcataat-tatgcaggggtcggggttcgaaccccggacac |
26902692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 27219619 - 27219546
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatct-ttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||| ||| |||||||| ||||||| |||||||||||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
27219619 |
tgcatgggccggggttcaaaccccgtacaccccacttattcacctaataaggtgaat---tctagccactaggctac |
27219546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 181
Target Start/End: Complemental strand, 28378118 - 28378080
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| ||||||||||||||| |||||||||||||||| |
|
|
| T |
28378118 |
aggggttggggttcgaaccccgaacaccccacttattca |
28378080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 33729817 - 33729890
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||||||||||| | | ||||||||||||||||| ||| |||||||||| |||| |||||||||||| |
|
|
| T |
33729817 |
tgcaggggccggggttcgaatctcagacaccccacttattcaccttataaggtgaat---tctaaccactaggctac |
33729890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #173
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 34398461 - 34398535
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
34398461 |
tgagcttaactcaattggtagagatatcgcattttatatgcaggagtcggggttcgaaccccggacactccactt |
34398535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #174
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 34436852 - 34436914
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| ||| |||||||| ||||||| |
|
|
| T |
34436852 |
tgagcttagctcagttggtagggacaatgcataatatatgcaagggccggggttcaaaccccg |
34436914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #175
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 92 - 162
Target Start/End: Original strand, 35241390 - 35241460
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||| || |||||||| ||| |||||| |||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
35241390 |
tcaatctccgtgagcttagttcagttggtagagatattgcatattatatgcaggggtcggggttcgaaccc |
35241460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #176
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 37986923 - 37986844
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt---taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||| |||||| ||| |||||||||||| |||||||||||| ||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
37986923 |
tgcagaggtcggagtttgaaccccggacatcccacttattcaccttgaaaaaggtgaat---tctagccactaggctacttga |
37986844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #177
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 39914902 - 39914963
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| |||| |||||||||||||| |
|
|
| T |
39914902 |
tgagcttaactcaattggtaaggacaatgcataatatatgca-aggtccgggttcgaaccccg |
39914963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #178
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 43580886 - 43580956
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||||||||| |||||| |
|
|
| T |
43580886 |
cttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccactt |
43580956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #179
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 142 - 179
Target Start/End: Complemental strand, 973030 - 972993
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||||| ||||||||||||||||||| ||||||||||| |
|
|
| T |
973030 |
caggggccggggttcgaaccccggaccccccacttatt |
972993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #180
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 1670398 - 1670455
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
||||||||| ||| |||||| ||||| ||||| ||| |||||||||||||||||||| |
|
|
| T |
1670398 |
tgagcttatatcagttggtagggatatggcatattatatgcaggggtcggggttcgaa |
1670455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #181
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 9409006 - 9408965
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| |||||||||||||||||| || ||||||| |
|
|
| T |
9409006 |
tgcaggggtcggagttcgaaccccggacacctcatttattca |
9408965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #182
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 13754045 - 13754102
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
13754045 |
tgcaggggtcgatgttcgaacgtcggacaccccatttattcatcttataaggtgaatt |
13754102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #183
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 13862164 - 13862208
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
13862164 |
tgcaggggtcggagttcgaaccc-ggacaccccacttattcttctt |
13862208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #184
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 17137923 - 17137882
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||| |||||||||||||||| ||||| ||||||||||| |
|
|
| T |
17137923 |
tgcagggatcggggttcgaacccccgacactccacttattca |
17137882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #185
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 18102005 - 18101964
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||||||||||| |
|
|
| T |
18102005 |
tgcaggggccggagttcgaaccccagacaccccacttattca |
18101964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #186
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 19608652 - 19608693
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||||||| |
|
|
| T |
19608652 |
tgcaggggtcggggttcgaactccggacacttcacttattca |
19608693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #187
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 24397986 - 24397945
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||| ||||||||||||||||| ||||||||||||||| |
|
|
| T |
24397986 |
tgcagggttcggggttcgaaccccgatcaccccacttattca |
24397945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #188
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 144 - 181
Target Start/End: Original strand, 27006383 - 27006420
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||| |||||||| ||||||||||| |
|
|
| T |
27006383 |
ggggtcggggttcgaactccggacactccacttattca |
27006420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #189
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 204
Target Start/End: Complemental strand, 28383423 - 28383342
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
||||||||| ||||| ||||| ||| | ||||||||| || ||||| |||||||| ||||| ||| |||||||||||||| |
|
|
| T |
28383423 |
ggataatgcgtaatacgtgcaatagtctgagttcgaacctcgaacaccacacttatttatcttaaagatgaatttctctagc |
28383342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #190
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 28871365 - 28871316
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||||||||||||||| ||||||||| |||||| |
|
|
| T |
28871365 |
aatgcattttatatgcaggggtcggggttcgaatcccggacactccactt |
28871316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #191
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 154 - 220
Target Start/End: Complemental strand, 29629987 - 29629923
Alignment:
| Q |
154 |
ttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| ||||||| |||||||||||||| |||||||||| ||||||||| || ||||||||| |
|
|
| T |
29629987 |
ttcgaaccctggacacctcacttattcatcttataaggtgaat---tctagccaccagactacttgac |
29629923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #192
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 30209042 - 30208993
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
30209042 |
aatgcattttatatgcaggggtcggggttcgaacctcgggcaccccactt |
30208993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #193
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 33018590 - 33018518
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| ||||| ||||| |||||||| | ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
33018590 |
gagcttaactcaactggtagggatattgcataatttatgcaggg-tcggggttcgaacttcggacaccccactt |
33018518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #194
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 177
Target Start/End: Original strand, 36869843 - 36869880
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactta |
177 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
36869843 |
tgcaggggtcagtgttcgaaccccggacaccccactta |
36869880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #195
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 43108570 - 43108627
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || || ||||||||| |
|
|
| T |
43108570 |
tgagcttaactcagttggtaaggacaatgcataatatatgcaaggttcagggttcgaa |
43108627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 166
Target Start/End: Original strand, 3671219 - 3671283
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
|||||||| |||| ||| ||||||||||| ||||||| |||| || | |||||||||||||||| |
|
|
| T |
3671219 |
tgagcttaactcagttgataaggataatgtataatatatgcaaggtccagggttcgaaccccgga |
3671283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 6624777 - 6624845
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||| | ||| |||||||||||| |||| || ||||||||||||||||| |||| |
|
|
| T |
6624777 |
tgagcttagctcagttggcatggacaatgcataatatatgcaaggtccggggttcgaaccccggccacc |
6624845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 6735817 - 6735781
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||||| |||| |||||| |
|
|
| T |
6735817 |
tgcaggggtcggggttcgaaccccgaacactccactt |
6735781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 7171770 - 7171806
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
7171770 |
tgcaggggccggggttcgaaccccagacaccccactt |
7171806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 210
Target Start/End: Complemental strand, 7608157 - 7608049
Alignment:
| Q |
103 |
gagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||| ||| |||||||||| ||| | || | | |||| ||||||||||| |||||| |||||||| ||||| ||| | ||||||| | |
|
|
| T |
7608157 |
gagcttaactcatttgataaaggataatgcacaatttatgtaaagatcggagttcgaaccccagacacctcacttatttatcttaaagttcaatttcttt |
7608058 |
T |
 |
| Q |
202 |
agccactag |
210 |
Q |
| |
|
| ||||||| |
|
|
| T |
7608057 |
atccactag |
7608049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 11720895 - 11720962
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| ||||||||||| |||||||| |||| |
|
|
| T |
11720895 |
tgagcttaactcagttggtagggacaatgcataatatatgca-aggtcggggttcaaaccccggccacc |
11720962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 11784849 - 11784885
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
11784849 |
tttaaggtgaatttctctaaccactaggctatttgac |
11784885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 14487603 - 14487678
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||||||||| |||| | |||||||||||| ||| |||||||||| |||||||| ||| ||||||||| |
|
|
| T |
14487603 |
aggggttggggttcgaacctcggatatcccacttattcaccttataaggtgaat---tctagccattagactacttgac |
14487678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 17279005 - 17278950
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||| | |||| | |||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
17279005 |
tgcataatttatgcaagagtcggggttccaaccccggac-ccccacttattcatctt |
17278950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 158
Target Start/End: Original strand, 18815352 - 18815408
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcga |
158 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||| ||| |||||| | |||||||||| |
|
|
| T |
18815352 |
tgagcttagctcagttggtaaggatattgcatattatatgcaggcgccggggttcga |
18815408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 196
Target Start/End: Original strand, 24205486 - 24205529
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| | | |||||||||||| |
|
|
| T |
24205486 |
ggttcgaaccccggacaccccacttattta-ccttaaggtgaatt |
24205529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 180
Target Start/End: Original strand, 25660951 - 25660991
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||||||| |
|
|
| T |
25660951 |
tgcaggggccgggattcgaaccccagacaccccacttattc |
25660991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 188
Target Start/End: Complemental strand, 27545203 - 27545131
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||||| ||| |||||||||||| |||| |||||| ||||| || | |||||||| ||||| ||||| ||||| |
|
|
| T |
27545203 |
ttggtagggacaatgcataatatatgcaagggtcgaggttcaaatctcggacacctcacttcttcatatttaa |
27545131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 29144143 - 29144222
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||| || || |||||||||||||||| |||| || ||||||||| ||||||| |
|
|
| T |
29144143 |
tgagcttaactcagttggta-ggacaatgcattattatatgcaggggtcggggtttgaactccagacaccccatttattca |
29144222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 143 - 187
Target Start/End: Original strand, 29748823 - 29748867
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatcttta |
187 |
Q |
| |
|
||||||| |||||||||| | |||||||||||||||||| ||||| |
|
|
| T |
29748823 |
aggggtcagggttcgaacacaggacaccccacttattcaccttta |
29748867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 117 - 173
Target Start/End: Original strand, 32623412 - 32623468
Alignment:
| Q |
117 |
tggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||| |||| |||||| ||| | ||||||||| ||||||||| |||||||||||| |
|
|
| T |
32623412 |
tggtaaagatattgcatattatatacaggggtcgaggttcgaactccggacacccca |
32623468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 37034807 - 37034883
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
||||||||||| |||| |||||| ||||| |||| ||| |||||| | ||| ||||||||||||||||| ||||| |
|
|
| T |
37034807 |
ccatgagcttagctcaattggtagggatatcgcattttatatgcaggagccggagttcgaaccccggacactccact |
37034883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 37932331 - 37932391
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || |||||||||||||| |
|
|
| T |
37932331 |
tgagcttagctcagttggtatggacaatgcataatatatgcaaggtccggggttcgaaccc |
37932391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 42169005 - 42168937
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||||||| |||||||||| |||||||| ||| |||| || |||||||||||||| |||||| |
|
|
| T |
42169005 |
tgagtttatctcagttggtaaggacaatgcatagtatatgcaaggtctggggttcgaaccccagacacc |
42168937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 42260776 - 42260728
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
||||||| ||||| ||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
42260776 |
tgcagggttcgggtttcgaactccggacatcccacttattcacctttaa |
42260728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 181
Target Start/End: Complemental strand, 42553192 - 42553156
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||| |
|
|
| T |
42553192 |
gggtcggggttcgaaccccggacactacacttattca |
42553156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 100; Significance: 2e-49; HSPs: 252)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 48433808 - 48433685
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48433808 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcaaaccccggacaccccacttattcatctttaaggtgaattt |
48433709 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48433708 |
ctctagccactaggctacttgacc |
48433685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 95; E-Value: 1e-46
Query Start/End: Original strand, 100 - 221
Target Start/End: Original strand, 31793466 - 31793588
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||||||| ||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
31793466 |
catgagcttagctcatttgttaagggataatgcacaatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtggatttc |
31793565 |
T |
 |
| Q |
199 |
tctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
31793566 |
tctagccactaggttacttgacc |
31793588 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 115 - 221
Target Start/End: Complemental strand, 4956174 - 4956067
Alignment:
| Q |
115 |
tttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggct |
213 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4956174 |
tttggtaagggataatgcacaatatgtgcaggggtcggggttcgaaccctggacaccccacttattcatctttaaggtgaatttctctagccactaggct |
4956075 |
T |
 |
| Q |
214 |
acttgacc |
221 |
Q |
| |
|
|||||||| |
|
|
| T |
4956074 |
acttgacc |
4956067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 205
Target Start/End: Original strand, 40273818 - 40273925
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40273818 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
40273917 |
T |
 |
| Q |
198 |
ctctagcc |
205 |
Q |
| |
|
|||||||| |
|
|
| T |
40273918 |
ctctagcc |
40273925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 27454008 - 27454132
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| ||||||||||||| |||||||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
27454008 |
ccatgagcttagctcatttggtaagggataatgcacaatttgtgcaggggtcgaggttcgaacctcggacaccccacttattcatcttaaaaggtgaatt |
27454107 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||||| |
|
|
| T |
27454108 |
tctctagccactaggctacttgacc |
27454132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 96 - 221
Target Start/End: Original strand, 12166076 - 12166202
Alignment:
| Q |
96 |
tcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaa |
194 |
Q |
| |
|
||||||||| |||| |||||||||||||| |||||||| ||| |||||||||| |||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12166076 |
tcaccatgaacttagctcatttggtaagggataatgcacaatttgtgcaggggctggggttcgaaccccagacaccccacttattcatctttaaggtgaa |
12166175 |
T |
 |
| Q |
195 |
tttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| |||| |||||||||| |
|
|
| T |
12166176 |
tttctctagctactaaactacttgacc |
12166202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 23824689 - 23824569
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||| ||| || ||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
23824689 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcatgggccgaggttcgaaccc-ggacaccctacttattcatctttaaggtgaattt |
23824591 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||||| ||||||| |
|
|
| T |
23824590 |
ctctagccactaggttacttga |
23824569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 99 - 210
Target Start/End: Original strand, 42554631 - 42554743
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||||| ||||||||||||||||| |||| ||||||||||||||| ||||||||| |
|
|
| T |
42554631 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggttggggttcgaaccccggatacccgacttattcatctttatggtgaattt |
42554730 |
T |
 |
| Q |
198 |
ctctagccactag |
210 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
42554731 |
ccctagccactag |
42554743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 33248900 - 33248777
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| || ||||| ||||| ||||| |||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33248900 |
ccatgagcttagctcatttggtaagggatgatgcacaatatatgcagaggtcggggttcgaaccccggacaccctacttattcatctttaaggtgaattt |
33248801 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|| | | |||||| |||||||||| |
|
|
| T |
33248800 |
ctttcgtcactagactacttgacc |
33248777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 114 - 220
Target Start/End: Original strand, 38378231 - 38378338
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||| ||||||||||||||||||| |||||| || |
|
|
| T |
38378231 |
atttggtaagggataatgcacaatatgtgcaggggccggggtttgaaccccggacaccccacttattcatttttaaggtgaatttctctacccactaagc |
38378330 |
T |
 |
| Q |
213 |
tacttgac |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
38378331 |
tacttgac |
38378338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 111 - 221
Target Start/End: Complemental strand, 3961494 - 3961383
Alignment:
| Q |
111 |
ctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||| |||||||||| ||| ||||||| || |||||||||||||||||||| ||||||||||||| || |||||||||||||||||| |||| |
|
|
| T |
3961494 |
ctcatttggtaaaggataatgcacaatttgtgcagaggccggggttcgaaccccggacatcccacttattcattttaaaggtgaatttctctagctacta |
3961395 |
T |
 |
| Q |
210 |
ggctacttgacc |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
3961394 |
ggctacttgacc |
3961383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 24029982 - 24030104
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||| ||||| |||||||| |||||||| ||||| ||||||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
24029982 |
ccatgagtttagctcatttgataagggataatgcacaatatgtgtaggggccggggttcgaaccccagacaccccatttattcatctttaaggtgaattt |
24030081 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||| |||||||||| |
|
|
| T |
24030082 |
ctctagcc-ctagactacttgacc |
24030104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 15025153 - 15025274
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||| | | | |||||| |||||||| ||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
15025153 |
ccatgagcttaactcatttggtaagggataatgcatattttatacaggggccggggttcaaaccccgaacaccccacttattcacctttaaggtgaattt |
15025252 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
||||| || ||||||||||||| |
|
|
| T |
15025253 |
ctctacccgctaggctacttga |
15025274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 114 - 210
Target Start/End: Original strand, 43440701 - 43440798
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
||||||||||| |||||||| ||||||||||| |||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43440701 |
atttggtaagggataatgcacaatatgtgcagaggtcggggttcgaattccagacaccccacttattcatctttaaggtgaatttctctagccactag |
43440798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 14707290 - 14707412
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| ||| ||||||||| |||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
14707290 |
ccatgagcttagctcatttggtaagggataatgcatt-tatatgcaggggttggggttcgaaccccggacaccccacttattcacctttatagtgaattt |
14707388 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| |||||||||| |
|
|
| T |
14707389 |
ctctagccgttagactacttgacc |
14707412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 28914951 - 28914852
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtc-ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| ||| |||||||| | |||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||| |
|
|
| T |
28914951 |
ggataatgcatattatatgcagggggccggggttcgaaccccggacaccccacttattcactttaaaggtgaatttctctagccactaggctacttgacc |
28914852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 99 - 217
Target Start/End: Complemental strand, 36528317 - 36528198
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||| ||||||||| |||||||||||||||| ||||| ||||||| |||||||||||||| |
|
|
| T |
36528317 |
ccatgagcttaactcatttggtaagggataatgcacaatatgtataggggtcggagttcgaaccccggacatcccacctattcatttttaaggtgaattt |
36528218 |
T |
 |
| Q |
198 |
ctctagccactaggctactt |
217 |
Q |
| |
|
| |||||||||| |||||| |
|
|
| T |
36528217 |
atttagccactagactactt |
36528198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 23602274 - 23602394
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||| |||||| ||||||||| ||| ||||| | ||| |||||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
23602274 |
tgagcttagctcatttgataaggaataatgcatattatatgcagtgaccggagttcgaaccccggacacctcacttattcacctttaaggtgaatttctt |
23602373 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
23602374 |
tagccactagactacttgacc |
23602394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 102 - 217
Target Start/End: Original strand, 37665744 - 37665860
Alignment:
| Q |
102 |
tgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||| |||||| |||| ||| |||||||| |||||||| ||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
37665744 |
tgagcttaactcatttggtaaaggataaaacatattatatgcaggggccggggttcaaaccccggacaccccacttattcgcctttaaggtgaatttctt |
37665843 |
T |
 |
| Q |
201 |
tagccactaggctactt |
217 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
37665844 |
tagccactagactactt |
37665860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 99 - 218
Target Start/End: Original strand, 48619794 - 48619913
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||||||| |||||||| | ||||||||||||||| ||| ||||||| | ||||| ||||||||||||||||||||||||||| |
|
|
| T |
48619794 |
ccatgagtttaactcatttggtaaaggataatgtacaatatgtgcaggggttggg-ttcgaacttcagacactccacttattcatctttaaggtgaattt |
48619892 |
T |
 |
| Q |
198 |
ctctagccactaggctacttg |
218 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
48619893 |
ctctagccactaagctacttg |
48619913 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 5228068 - 5228190
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||| ||| ||| ||||||||||| | | |||||||| ||||||||||| || |||||||||||||||||| ||||||||||||||| |
|
|
| T |
5228068 |
ccatgagcttagctcacttgataaaggataatgcatttt-tatgcaggggccggggttcgaatcctggacaccccacttattcacctttaaggtgaattt |
5228166 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||| |
|
|
| T |
5228167 |
ctctagccgctaggctacttgacc |
5228190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 46266665 - 46266787
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| ||||| |||| ||||||||||||| | ||| |||||||||||||||| ||||||||||| |
|
|
| T |
46266665 |
ccatgagcttaactcatttggtaagggataatgcacaatttgtgcgggggacggggttcgaaccttgaacatcccacttattcatcttaaaggtgaattt |
46266764 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||||| ||||||||| |
|
|
| T |
46266765 |
atctaaccactagactacttgac |
46266787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 100 - 221
Target Start/End: Complemental strand, 3889898 - 3889775
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcg-gggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||||||| |||||||| |||| |||||| | ||||| |||||||| | ||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
3889898 |
catgagcttagctcatttgacaagggataatgtacaatatatgcagggggccagggttcgaaccccggacaccccacttattcatcttaaaggtgaattt |
3889799 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| ||| |||| ||||||||| |
|
|
| T |
3889798 |
ctctaaccattaggttacttgacc |
3889775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 102 - 213
Target Start/End: Complemental strand, 44662558 - 44662446
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| | ||||||| ||||||||| || | |||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
44662558 |
tgagcttagctcactaggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacaccccactatttcacctttaaggtgaatttctc |
44662459 |
T |
 |
| Q |
201 |
tagccactaggct |
213 |
Q |
| |
|
|||| ||||||| |
|
|
| T |
44662458 |
cagccgctaggct |
44662446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 177
Target Start/End: Complemental strand, 42338345 - 42338266
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactta |
177 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| |||||||||||||| ||||||||||| ||||||||||||||||| |
|
|
| T |
42338345 |
ccatgagcttagctcatttggtaaggaataatgcacaatatgtgcaggggacggggttcgaatcccggacaccccactta |
42338266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 48525586 - 48525697
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||| ||||||||| | |||||||| ||| ||||||||| ||||||||||||||||||||| |||||||||| ||||||| | ||||||||||||| || |
|
|
| T |
48525586 |
ctcacttggtaagggacaatgcatattatatgcaggggttggggttcgaaccccggacacctcacttattcacctttaagttagatttctctagccatta |
48525685 |
T |
 |
| Q |
210 |
ggctacttgacc |
221 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
48525686 |
ggatacttgacc |
48525697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 26456103 - 26455982
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||| ||||||||||||| | ||| ||||||| ||||| ||| ||||||| ||| ||||||||||| |
|
|
| T |
26456103 |
ccatgagcttagctcatttggtaagggacaatgcacaatatgtgcagggactgacgtttgaaccccagacactccagttattcaccttaaaggtgaattt |
26456004 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
26456003 |
ctctagccactagactacttga |
26455982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 101 - 220
Target Start/End: Original strand, 37918679 - 37918799
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaa-ccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||| |||| |||||||| ||||| |||||||| || ||||| ||| ||||||||||||| ||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
37918679 |
atgaacttaactcatttgataagggataatgcacaa-atgtgtaggcgtcggggttcgaatccccggacacctcacttattcatcttttaggtgaatttc |
37918777 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
|||| |||||| ||||||||| |
|
|
| T |
37918778 |
tctaaccactaaactacttgac |
37918799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 102 - 202
Target Start/End: Original strand, 46243291 - 46243392
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||| ||| | |||| |||| |||||||| ||| |||||||||||||||| |||||||||||||||||| |
|
|
| T |
46243291 |
tgagcttagctcatttggtaagggataatgcatattatatatagggatcggagttcgaactccgaacaccccacttattcacctttaaggtgaatttctc |
46243390 |
T |
 |
| Q |
201 |
ta |
202 |
Q |
| |
|
|| |
|
|
| T |
46243391 |
ta |
46243392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 10091513 - 10091433
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||||||| |||| ||||| |
|
|
| T |
10091513 |
tgcaggggccggggttcgaaccctagacacccaacttattcacctttaaggtgaatttctctagccactacgctatttgac |
10091433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 29658328 - 29658249
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
29658328 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacttgacc |
29658249 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 9712264 - 9712190
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9712264 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccactt |
9712190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 111 - 220
Target Start/End: Original strand, 20529906 - 20530015
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||||| ||||||||| | | ||||||| ||||||||| | |||||||||||||||||||||| ||||||||||||||||||||| | | |
|
|
| T |
20529906 |
ctcatttggtaagggataatgcatt-tgtatgcagggatcggggttcaagccccggacaccccacttattcacctttaaggtgaatttctctagtcgttg |
20530004 |
T |
 |
| Q |
210 |
ggctacttgac |
220 |
Q |
| |
|
||||||||||| |
|
|
| T |
20530005 |
ggctacttgac |
20530015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 102 - 219
Target Start/End: Complemental strand, 24315448 - 24315331
Alignment:
| Q |
102 |
tgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||| |||||||| ||||||||||||||||||||| ||| ||||||||| || ||||||||||| ||||| |
|
|
| T |
24315448 |
tgagcttagctcatttagtaatggataatgcacaatatgtgtaggggtcggggttcgaaccccatacattccacttatttat-tttaaggtgaacttctc |
24315350 |
T |
 |
| Q |
201 |
tagccactaggctacttga |
219 |
Q |
| |
|
|| ||||||| ||||||| |
|
|
| T |
24315349 |
taaccactagattacttga |
24315331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 134 - 208
Target Start/End: Complemental strand, 42841843 - 42841769
Alignment:
| Q |
134 |
aatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccact |
208 |
Q |
| |
|
|||||||||| || ||||||||||||||| ||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
42841843 |
aatatgtgcaaggaccggggttcgaaccccagacaccccacttattcatcttaaaggtgaatttctctagacact |
42841769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 143 - 220
Target Start/End: Complemental strand, 26606162 - 26606085
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||| |||||| |||||| ||||||||||| ||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
26606162 |
aggggccggggtttgaaccctggacactccacttattcacctttaaggtgaatttctctagccgcttggctacttgac |
26606085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 142 - 220
Target Start/End: Complemental strand, 33202608 - 33202532
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
33202608 |
caggggccggggttcgaaccccggacaccccacttattcatcttataaggtgaat---tctagccactaggctacctgac |
33202532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 46195940 - 46196037
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| || || | |||||||||||||||| ||||||||||||||||||| |||| |||||||||||||||||| |||| |||| || |||||| |
|
|
| T |
46195940 |
ggataatgtattatgtatgcaggggtcggggtttgaaccccggacaccccactatttcacctttaaggtgaatttctccagccgctagtctgcttgac |
46196037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 114 - 220
Target Start/End: Original strand, 22156110 - 22156216
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
||||||||||| |||||| | ||||||||| ||| || ||||||||| | ||||||||||||||||||||| |||| |||||||||||| ||||||| | |
|
|
| T |
22156110 |
atttggtaagggataatgtacaatatgtgc-gggatcatggttcgaacgctggacaccccacttattcatctataagatgaatttctctaaccactagac |
22156208 |
T |
 |
| Q |
213 |
tacttgac |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
22156209 |
tacttgac |
22156216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 114 - 220
Target Start/End: Original strand, 22212025 - 22212131
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
||||||||||| |||||| | ||||||||| ||| || ||||||||| | ||||||||||||||||||||| |||| |||||||||||| ||||||| | |
|
|
| T |
22212025 |
atttggtaagggataatgtacaatatgtgc-gggatcatggttcgaacgctggacaccccacttattcatctataagatgaatttctctaaccactagac |
22212123 |
T |
 |
| Q |
213 |
tacttgac |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
22212124 |
tacttgac |
22212131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 6548805 - 6548688
Alignment:
| Q |
103 |
gagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||| || ||||||| |||||||| || | ||||||| |||||||||||| |||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
6548805 |
gagcttagctcacttagtaaggaataatgcattatgtatgcagggc-cggggttcgaactccggacaccccactatttcacctttaaggtgaatttctcc |
6548707 |
T |
 |
| Q |
202 |
agccactaggctacttgac |
220 |
Q |
| |
|
||| |||||||||||||| |
|
|
| T |
6548706 |
ggccgctaggctacttgac |
6548688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 9877333 - 9877259
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9877333 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
9877259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 21285409 - 21285336
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
21285409 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctac |
21285336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 23102624 - 23102550
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
23102624 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
23102550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 47440880 - 47440802
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||| || |||||||||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47440880 |
ccatgagcttagctcagttggtagggacaaatgcataatatatgcaggggtcggggttcgaaccctggacaccccactt |
47440802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 48258281 - 48258160
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| || |||||||||| |||||||||| | | || ||| ||||| ||||||||||||||||||||| ||||||| |||||| |||||||| |
|
|
| T |
48258281 |
ccatgaacttaacttatttggtaagtgataatgcatt-tgtatgtaggagtcggagttcgaaccccggacaccccatttattcacctttaaagtgaattt |
48258183 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| ||||||||| |||| |
|
|
| T |
48258182 |
gtctagccgctaggctacctgac |
48258160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 28712366 - 28712486
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||||||||||||| |||||| ||||||||||||||| ||| | |||||| ||| || || |||||||||||||| ||||||||| |
|
|
| T |
28712366 |
catgagcttaactcatttggtaagggataatgtataatatgtgcagggatcgag-ttcgaattttggatgcctcatttattcatctttaaagtgaatttc |
28712464 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||| |||||||||| |
|
|
| T |
28712465 |
tctagtcactaagctacttgac |
28712486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 100 - 196
Target Start/End: Original strand, 44986592 - 44986689
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatt |
196 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| ||| |||||| || |||| |||||||||| ||||||||||||| |||||| |||||||||| |
|
|
| T |
44986592 |
catgagcttagctcatttggtaagggataatgcacaattagtgcagtggccgggattcgaaccccaaacaccccacttatccatcttaaaggtgaatt |
44986689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 10624853 - 10624774
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| |||||||||| ||||||||||||||||||||||| || | ||||||||| |
|
|
| T |
10624853 |
tgcaggggtcagggttcgaaccccaaacaccgcacttattca-ctttaaggtgaatttctctagccgcttgactacttgac |
10624774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 32986384 - 32986463
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||| ||| ||||||||| |||||||||| |||| |||||||||||||||||||||||||| ||||| |
|
|
| T |
32986384 |
tgcaggggtcggggtttgaatcccggacacttcacttattcacattta-ggtgaatttctctagccactaggctatttgac |
32986463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 103 - 221
Target Start/End: Complemental strand, 3902367 - 3902258
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||||||||||| |||||||||||||||| ||||||||||| ||||||||||| ||| |
|
|
| T |
3902367 |
gagcttagctcatttggtaagggataatgcaaaatatgtgcagggc-cggggttcgaaccccgatcaccccactta---------aaggtgaatttatct |
3902278 |
T |
 |
| Q |
202 |
agccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
3902277 |
agccactaggttacttgacc |
3902258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 99 - 201
Target Start/End: Complemental strand, 25775711 - 25775608
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||| ||||||| |||||||| ||||||| |||| | || ||||||||| || |||||||||||||||||||||||||||||||| |
|
|
| T |
25775711 |
ccatgagtttagctcacttggtaaaggataatgtataatatatgcaagaaccgaggttcgaactccaaacaccccacttattcatctttaaggtgaattt |
25775612 |
T |
 |
| Q |
198 |
ctct |
201 |
Q |
| |
|
|||| |
|
|
| T |
25775611 |
ctct |
25775608 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 101 - 176
Target Start/End: Original strand, 28805303 - 28805378
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| |||| |||||| ||||| |||||| || |||||||||||||||| |||||||||||||||||||| |
|
|
| T |
28805303 |
atgagcttagctcagttggtagggatattgcatatcatatgcaggggtcggggttagaaccccggacaccccactt |
28805378 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 111 - 205
Target Start/End: Complemental strand, 34322110 - 34322015
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
|||||||| ||||| |||||||| ||||||||||||| |||||| ||| ||| ||||||||| ||||||||||| || |||||||||||||||| |
|
|
| T |
34322110 |
ctcatttgataagggataatgcacaatatgtgcagggactggggtttgaatcccagacaccccatttattcatcttaaacgtgaatttctctagcc |
34322015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 122 - 205
Target Start/End: Complemental strand, 36977315 - 36977232
Alignment:
| Q |
122 |
aggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
||||||||||||||| | || || |||||| ||||||||| ||||||||| | ||||||| ||||||||||| ||||||||||| |
|
|
| T |
36977315 |
aggataatgcataatttatgtagaggtcggtgttcgaacctcggacaccctatttattcacctttaaggtgagtttctctagcc |
36977232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 4590658 - 4590589
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||| |||||||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
4590658 |
gggttcgaatcccggacaccacacttattcatcttataaggtgaattt-tctagccactaggctacctgac |
4590589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 99 - 160
Target Start/End: Original strand, 8249702 - 8249764
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
||||||||||| |||| ||||||| |||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
8249702 |
ccatgagcttagctcacttggtaaaggataatgcataatatatgcaggggtcggggttcgaac |
8249764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 13295469 - 13295351
Alignment:
| Q |
103 |
gagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| || |||||||||| ||||||| || || | || ||||||||||||||||||| |||| | | || | |||| |||||||||||||||||| |
|
|
| T |
13295469 |
gagcttaacttatttggtaagagataatgtattatgtatgtaggggtcggggttcgaacctcggatatctcattatttcacctttaaggtgaatttctcc |
13295370 |
T |
 |
| Q |
202 |
agccactaggctacttgac |
220 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
13295369 |
agccgctaggctacttgac |
13295351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 15238893 - 15238967
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
15238893 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
15238967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 20013579 - 20013700
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| |||||||||||| ||||||||||| | | |||||||| || ||||||| |||||||| ||||||||| || ||||||| ||||||| |
|
|
| T |
20013579 |
ccatgaacttaactcatttggtaaaggataatgcatt-tgtatgcaggggccgaagttcgaatcccggacatcccacttatccacctttaagatgaattt |
20013677 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||| || ||||| |
|
|
| T |
20013678 |
ctctagccgctaggttatttgac |
20013700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 24188474 - 24188548
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||||||||||||||||||||| |||||||||||| |
|
|
| T |
24188474 |
tgagcatagctcagttggtagggatactgcatattatatgcaggggtcggggttcgaaccccagacaccccactt |
24188548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 35950132 - 35950206
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
35950132 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
35950206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 36391970 - 36391896
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
36391970 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
36391896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 121 - 203
Target Start/End: Complemental strand, 47324558 - 47324476
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctag |
203 |
Q |
| |
|
|||||||||||||||||| |||| | | | |||||||||| | ||||||||||||| ||| ||||||||||||||||||||| |
|
|
| T |
47324558 |
aaggataatgcataatatatgcatgagctgaggttcgaacctctgacaccccacttaatcacctttaaggtgaatttctctag |
47324476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 1563796 - 1563731
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1563796 |
ctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
1563731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 171
Target Start/End: Original strand, 1575691 - 1575764
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| || ||||||| ||||||| |||||||||||||| ||||||| |
|
|
| T |
1575691 |
ccatgagcttaactcatttggtaagggataatacacaatatgtacaggggttggggttcgaaccccagacaccc |
1575764 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 9497979 - 9498044
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| || |||||||||||||||||||||||||||||||||| |
|
|
| T |
9497979 |
ctcaattggtagggatattgcatattatatgtaggggtcggggttcgaaccccggacaccccactt |
9498044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 11808077 - 11808118
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11808077 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
11808118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 41139126 - 41139204
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||||||||| || || ||||||| |||||||||||||||||||||| |
|
|
| T |
41139126 |
tgcaggggtcggggttcgaatcccggacacttcacttattcactttaaaagtgaatt--tctagccactaggctacttgac |
41139204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 17900935 - 17900856
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||| ||||||||||||| |||||||||||| ||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
17900935 |
tgcaggggccggggctcgaaccccggactccccacttattctccttataaggtgaat---tctagccactaggctacttgacc |
17900856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 134 - 202
Target Start/End: Complemental strand, 18128967 - 18128899
Alignment:
| Q |
134 |
aatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||| ||||||| ||| || ||||||| ||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
18128967 |
aatatgtgtaggggtccgggctcaaaccccgaacaactcacttattcatctttaaggtgaatttctcta |
18128899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 152 - 221
Target Start/End: Original strand, 34948157 - 34948224
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
34948157 |
ggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
34948224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 41465840 - 41465912
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
41465840 |
agcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaactccggacaccccactt |
41465912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 46987087 - 46987155
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || |||||||||||||||||||||| |
|
|
| T |
46987087 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaaccccggacacc |
46987155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 2681100 - 2681167
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
2681100 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacac |
2681167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 202
Target Start/End: Original strand, 40011734 - 40011813
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
||||||| |||| ||| ||||||||||| ||||||||||||| ||| |||||||||| | ||||| ||||||||||||| |
|
|
| T |
40011734 |
ggataatacatattatatgcaggggtcgaggttcgaaccccgaacatcccacttatttacttttaaagtgaatttctcta |
40011813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3392471 - 3392545
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| || ||||||||||||||||||||| |||||||||||| |
|
|
| T |
3392471 |
tgagcttaactcagttgatatggatattgcatattatatgtaggggtcggggttcgaaccccagacaccccactt |
3392545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3766815 - 3766889
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
3766815 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
3766889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 10244955 - 10244881
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||| | |||||||||||||||||||||||||||| |
|
|
| T |
10244955 |
tgagcttagctcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacaccccactt |
10244881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 12772119 - 12772193
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| |||||||||||||||||||| || |||||| |
|
|
| T |
12772119 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggatactccactt |
12772193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 15106757 - 15106683
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
15106757 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccactt |
15106683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 181
Target Start/End: Complemental strand, 15716754 - 15716672
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||| ||| |||| |||||| ||||| ||| || ||| |||| |||||||||||||||| ||||||||||||||||||| |
|
|
| T |
15716754 |
ccatgagtttagctcagttggtagggatattgcgtattatatgcaagggtcggggttcgaacttcggacaccccacttattca |
15716672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19753034 - 19752960
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
19753034 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccactt |
19752960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 21762954 - 21762884
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| |||||||||||| |||||| ||| ||||||||||||| |||||||| | || ||||||||| |
|
|
| T |
21762954 |
cttatctcagttggtaaggatattgcatattatatgcaggggtcgggattcgaacctcagagaccccactt |
21762884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 24396984 - 24397063
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| |||||||||| |||||||| ||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
24396984 |
tgcaggggtcggagttcgaaccctggacaccctacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
24397063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 29617409 - 29617483
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
29617409 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
29617483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 30388573 - 30388499
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
30388573 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccactt |
30388499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 30806119 - 30806193
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
30806119 |
tgagtttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaaccccggacatcccactt |
30806193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 31191666 - 31191592
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||| ||| ||||||| |||| ||||||||||||||||| |||||| |
|
|
| T |
31191666 |
tgagcttaattcagttggtaaggatattgcatattatatgcagggatcggagttcgaaccccggacactccactt |
31191592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 32677008 - 32676934
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
32677008 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
32676934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 116 - 208
Target Start/End: Complemental strand, 35308015 - 35307921
Alignment:
| Q |
116 |
ttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt-attcatctttaaggtgaatttctctagccact |
208 |
Q |
| |
|
|||||||||| ||||||||||||| |||||| ||||| |||||| || ||||||||||| ||||| ||||||||||||||||||||| |||| |
|
|
| T |
35308015 |
ttggtaaggaataatgcataatatatgcaggactcgggattcgaatttcgaacaccccactttattcacctttaaggtgaatttctctagtcact |
35307921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 36174394 - 36174468
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
36174394 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
36174468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 41417331 - 41417252
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| || || ||||||| | |||||| ||| |||||||||| |
|
|
| T |
41417331 |
tgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaagtgaatt--tttagccattagactacttgacc |
41417252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 45284885 - 45284811
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||| | || ||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45284885 |
tgagcttagctcagttgatagggacattgaataatttatgcaggggtcggggttcgaaccccggacaccccactt |
45284811 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 1398972 - 1398895
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| |||| ||||| ||||| |||||| ||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
1398972 |
ccattagcttaactcagttggttgggatattgcatattatatgcaggggccggggttcgaatcccggacaccccactt |
1398895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 14102500 - 14102557
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
14102500 |
tgcaggggccggggtttgaaccccggacaccccacttattcaccttataaggtgaatt |
14102557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 14412517 - 14412574
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
14412517 |
tgcaggggccggggtttgaaccccggacaccccacttattcaccttataaggtgaatt |
14412574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 25155542 - 25155619
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| ||| |||| || ||||||||||| | | ||||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
25155542 |
ccatgagcttagttcagttggcaaagataatgcatattttatgcagggttcggggttcgaaccctggacaccccactt |
25155619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 123 - 200
Target Start/End: Complemental strand, 29132088 - 29132011
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
||||||||||| || | |||| | ||||||||| ||||||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
29132088 |
ggataatgcattatgtatgcaagagtcggggtttgaaccccagacaccccactattttatctttaaggtgaatttctc |
29132011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 91 - 176
Target Start/End: Original strand, 31026212 - 31026297
Alignment:
| Q |
91 |
atcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| || ||||| || |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
31026212 |
atcaatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
31026297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 163
Target Start/End: Original strand, 41084043 - 41084104
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41084043 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaacccc |
41084104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 175
Target Start/End: Complemental strand, 42182264 - 42182191
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||||| |||| |||||| || || |||||| ||| ||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
42182264 |
tgagcttaactcagttggtaggggtattgcatattatatgcaggggtcggggttcgaactccggacactccact |
42182191 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 43635627 - 43635668
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
43635627 |
tgcagcggtcggggttcgaaccccggacaccccacttattca |
43635668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 168 - 220
Target Start/End: Original strand, 1576373 - 1576425
Alignment:
| Q |
168 |
accccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| | |||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
1576373 |
accccacttattcgtttttaaggtgaatttctctagccaccaggctatttgac |
1576425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 141 - 185
Target Start/End: Complemental strand, 3955100 - 3955056
Alignment:
| Q |
141 |
gcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| |||||||||| ||||||||||||||||||||| |
|
|
| T |
3955100 |
gcaggggtcgggattcgaaccccagacaccccacttattcatctt |
3955056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 94 - 174
Target Start/End: Original strand, 21388519 - 21388599
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||| |||||||| || |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||| |
|
|
| T |
21388519 |
aatccccatgagcgtagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccac |
21388599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 22690096 - 22690028
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||| |||| |||||||||||||| |||| || | ||||||||||||||||||||| |
|
|
| T |
22690096 |
tgagcttagctcagttgctaagaataatgcataatatatgcaaggtttggggttcgaaccccggacacc |
22690028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 100 - 176
Target Start/End: Original strand, 27788271 - 27788347
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| || |||| |||| | ||||| |||||||| | |||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27788271 |
catgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccactt |
27788347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 100 - 176
Target Start/End: Original strand, 27791427 - 27791503
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| || |||| |||| | ||||| |||||||| | |||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
27791427 |
catgagcatagctcaattggcagggatattgcataatttatgcaggggccggggttcgaaccccagacaccccactt |
27791503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 33413903 - 33413951
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| ||||||| ||||| |
|
|
| T |
33413903 |
cacttattcatcttaaaggtgaatttctctagccattaggctatttgac |
33413951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 181
Target Start/End: Complemental strand, 36316049 - 36315989
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| || || |||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
36316049 |
aggataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattca |
36315989 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 38451902 - 38451981
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| || |||||||||| |||||||||||| |||| ||||| |
|
|
| T |
38451902 |
tgcaggggccggggttcgaatcccggacaccccacttattcacattataaggtgaat---tctagccactagactacctgacc |
38451981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 2366396 - 2366474
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| | ||||||||||||||||| ||| |||||||||| |||||||| |||||||| |||| |
|
|
| T |
2366396 |
tgcaggggtcggggttcgaactctagacaccccacttattcaccttataaggtgaat---tctagccattaggctacctgac |
2366474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 5787500 - 5787578
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||| ||||||| |||||||||||||||| ||| |||||||||| ||||| |||||||||||||||| |
|
|
| T |
5787500 |
tgcaggggccggggtttgaaccccaaacaccccacttattcaccttataaggtgaat---tctagtcactaggctacttgac |
5787578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 9668909 - 9668792
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||| | | ||||||| ||||||||||||| ||||| || ||||||| ||| |||||||||||||| |
|
|
| T |
9668909 |
tgagcttagctcacttggtaagggataatgcatatt-tatgcagggactagggttcgaaccccaaacacctcatttattcacctt-aaggtgaatttctc |
9668812 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
| ||| |||||||||||||| |
|
|
| T |
9668811 |
tggccgctaggctacttgac |
9668792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 173
Target Start/End: Original strand, 16200563 - 16200634
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| || | |||||| | ||| |||||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
16200563 |
tgagcttagcttaattggtaggaatattgcatattatatgcaggggtcggggttcgaaccccagacacccca |
16200634 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 21461746 - 21461667
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| ||||| ||| |||||||||| | |||| ||||||||||||||| | |||||| |||||||||||| |
|
|
| T |
21461746 |
tgagcttagctcagctggtagggacaatgcataatttatgcaagggtcggggttcgaatctcggacatcccacttattca |
21461667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 27907952 - 27907874
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| |||||| ||| | ||||||||||||||||||||||| |||||||||||| ||||||||||||||| |||| |
|
|
| T |
27907952 |
tgcaggggccggggtaagaatctcggacaccccacttattcatcttataaggtgaattt---tagccactaggctacctgac |
27907874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 29357801 - 29357919
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||| ||||| ||||||||| |||| ||||||| ||| |||||||||| |||||| ||||| |||| ||||||||||||||||| |
|
|
| T |
29357801 |
tgagcttagctcacttgataagggataatgcattatatatgcagggc-cggagttcgaaccctggacactccactatttcacctttaaggtgaatttctt |
29357899 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
||| |||||||| ||||| |
|
|
| T |
29357900 |
cggccgctaggctaattgac |
29357919 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 42443684 - 42443767
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||||||||| |||||| |
|
|
| T |
42443684 |
caatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccactt |
42443767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 47552252 - 47552330
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||| ||||||||||||||||||||||| ||||||||| ||| |||||||||| ||||||||| ||||||| |||| |
|
|
| T |
47552252 |
tgcaagggccggggttcgaaccccggacaccctacttattcaccttataaggtgaat---tctagccaccaggctacctgac |
47552330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 4960788 - 4960862
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| || ||| ||||| |||||| ||| |||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
4960788 |
tgagcttagctcagttagtagggatattgcatattatatgcaggagtcggggttcgaacccctgacactccactt |
4960862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 12640655 - 12640581
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||| ||||| |||||| |
|
|
| T |
12640655 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccactt |
12640581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 134 - 219
Target Start/End: Original strand, 24596144 - 24596230
Alignment:
| Q |
134 |
aatatgtgcaggggtcggggttcgaaccccggacaccccac-ttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||| | |||||||| |||| |||||||| | |||||||| | |||||||||||||||||||||| |||||||||| |
|
|
| T |
24596144 |
aatatgtgcaggagccggggttcaaacctttgacacccccccttattcatttcaaaggtgaatttctctagccactgggctacttga |
24596230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 24781034 - 24781108
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||| || |||||| |
|
|
| T |
24781034 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccactt |
24781108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 181
Target Start/End: Original strand, 30152783 - 30152821
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
30152783 |
aggggtcggggttcgaaccccgaacaccccacttattca |
30152821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 30644208 - 30644281
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||||||||||| ||| |||||||||| |||||||||||| |||| |
|
|
| T |
30644208 |
tgcaggggccggtgttcgaaccccagacaccccacttattcaccttataaggtgaat---tctagccactagtctac |
30644281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 163 - 221
Target Start/End: Original strand, 32376501 - 32376559
Alignment:
| Q |
163 |
cggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||| ||||| ||| |||||||||| |
|
|
| T |
32376501 |
cggacaccccatttattcaactttaaggtgaatttctttagccgctaaactacttgacc |
32376559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 32619354 - 32619428
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| |||||||| |||||| ||| || ||| | ||||||||||||||||||||| |||||| |
|
|
| T |
32619354 |
tgagcttaactcagttgttaaggatattgcatattatatgtaggagccggggttcgaaccccggacactccactt |
32619428 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 182
Target Start/End: Original strand, 32814866 - 32814908
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||| |
|
|
| T |
32814866 |
tgcaggggtcggagttcgaatcccggacaccccacttattcat |
32814908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 135 - 185
Target Start/End: Original strand, 33555103 - 33555153
Alignment:
| Q |
135 |
atatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||| |||| ||||| ||||||||||||||||||| ||||||||||||||| |
|
|
| T |
33555103 |
atatatgcaagggtcagggttcgaaccccggacactccacttattcatctt |
33555153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 35683193 - 35683119
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| ||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
35683193 |
tgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaactccggacactccactt |
35683119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 162 - 220
Target Start/End: Complemental strand, 37563285 - 37563227
Alignment:
| Q |
162 |
ccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| |||||||||| |||||| |||||||||||| || |||| ||||||||| |
|
|
| T |
37563285 |
ccggacaccctacttattcatttttaagatgaatttctctaaccgctagactacttgac |
37563227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 37930045 - 37930107
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
||||||||||||| |||||||||| |||||||||||| |||||| ||||| ||| ||||||| |
|
|
| T |
37930045 |
tgagcttatctcagttggtaaggacaatgcataatatatgcaggattcgggattcaaaccccg |
37930107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 38151348 - 38151422
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| || | |||||||||||||||||||||| | ||||||||||| |
|
|
| T |
38151348 |
tgagcttagctcagttggtagggatattgcattatttatgcaggggtcggggttcgaaccatgaacaccccactt |
38151422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 41331145 - 41331071
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||||||||||||||| ||||||||||||||| |
|
|
| T |
41331145 |
tgagcttagctcagttggcagggacattgcataatttatgcaggggtcggggttcgaattccggacaccccactt |
41331071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 214
Target Start/End: Original strand, 41468835 - 41468948
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| ||| |||||| ||||| | |||| |||| | |||||| ||||||||||| |||| |||||||||| |
|
|
| T |
41468835 |
atgagcttagttcatttggtaaggggtaatgcacaatttgtgcaagggtcagagttcaaacctcaaacaccctacttattcatc-ttaaagtgaatttct |
41468933 |
T |
 |
| Q |
200 |
ctagccactaggcta |
214 |
Q |
| |
|
| ||| ||||||||| |
|
|
| T |
41468934 |
ccagctactaggcta |
41468948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 44437881 - 44437843
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
44437881 |
tgcaggggccggggttcgaaccccggacaccccacttat |
44437843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 44843734 - 44843787
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||| |||||||||| ||||||||||| ||||||||||| |
|
|
| T |
44843734 |
aggggtcggggttcgaaccc-ggacaccccatttattcatcttataaggtgaatt |
44843787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 48119474 - 48119548
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
48119474 |
tgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccactt |
48119548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 2261540 - 2261483
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
2261540 |
tgcaggggccggggttcgaatcccggacacccaacttattcaccttataaggtgaatt |
2261483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 177
Target Start/End: Original strand, 7465505 - 7465542
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactta |
177 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7465505 |
tgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 10020525 - 10020480
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||| ||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
10020525 |
tgcaggggttggggttcgaaccccgaacaacccacttattcatctt |
10020480 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 10474568 - 10474527
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||| ||||||||||| |||||||||| |
|
|
| T |
10474568 |
tgcaggggtcggggttcgacccccggacacctcacttattca |
10474527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 97 - 170
Target Start/End: Complemental strand, 15021282 - 15021209
Alignment:
| Q |
97 |
caccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||||||| |||| |||||| ||| | |||||||| | | |||| |||||||||||||||||||||||| |
|
|
| T |
15021282 |
caccgtgagcttaactcaattggtagggagattgcataatttatacaggagtcggggttcgaaccccggacacc |
15021209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 21875673 - 21875620
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| |||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
21875673 |
ggatattgcatattatatgcaggggtcggagttcgaaccccggacactccactt |
21875620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 117 - 220
Target Start/End: Complemental strand, 21882274 - 21882170
Alignment:
| Q |
117 |
tggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttt---aaggtgaatttctctagccactaggct |
213 |
Q |
| |
|
||||| ||| ||||||| |||| |||||||||| ||||| ||| |||||||||| | |||||||| ||| ||||||||||||| ||| |||||||| |
|
|
| T |
21882274 |
tggtagggacaatgcatgatatatgcaggggtccgggtttgaagcccggacacctcgcttattcaccttatgaaaggtgaatttct--agctactaggct |
21882177 |
T |
 |
| Q |
214 |
acttgac |
220 |
Q |
| |
|
||||||| |
|
|
| T |
21882176 |
acttgac |
21882170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 22548224 - 22548289
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||||||| | |||||||| | | |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
22548224 |
ctcagttggtaaggacattgcataatttatacaggggtcagggttcgaaccccgaacaccccactt |
22548289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 216
Target Start/End: Original strand, 22741254 - 22741318
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctact |
216 |
Q |
| |
|
|||||||||| | ||||||||||||||||||||||| |||||||||| |||||||||||| ||||| |
|
|
| T |
22741254 |
ggggttcgaatctcggacaccccacttattcatcttataaggtgaat---tctagccactagactact |
22741318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 22966014 - 22965957
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| || |||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
22966014 |
tgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
22965957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 23685610 - 23685569
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||||||||||||| |
|
|
| T |
23685610 |
tgcaggggccggggttcgaaccccagacaccccacttattca |
23685569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 152 - 201
Target Start/End: Complemental strand, 25770086 - 25770037
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||||| || ||||||||||||||||||||||| |||||||||||| |
|
|
| T |
25770086 |
ggttcgaactccaaacaccccacttattcatctttaaagtgaatttctct |
25770037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 33996938 - 33996873
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| |||||||||||||||| |||||| |||||| |
|
|
| T |
33996938 |
ctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccctggacactccactt |
33996873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 35612636 - 35612559
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||| | |||||| ||| ||||| ||| |||||| ||||||||||||| |||||| |
|
|
| T |
35612636 |
ccatgagcttagctcaattggtagggagattgcatattatatgcagaggttggggtttgaaccccggacactccactt |
35612559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 180
Target Start/End: Complemental strand, 37240141 - 37240060
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||||||| |||| ||||||| || | |||||||||| | ||||||| |||||| ||||||| || |||||||||||| |
|
|
| T |
37240141 |
ccatgagcttaactcagttggtaaagacattgcataatatatacaggggttggggttggaaccccaaacgccccacttattc |
37240060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 95 - 176
Target Start/End: Original strand, 47463928 - 47464009
Alignment:
| Q |
95 |
atcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||||||| |||| |||||| ||| ||||| ||| ||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
47463928 |
atcaccgtgagcttaactcagttggtagaaatattgcatgttatatgcaggggttggggttcgaacctcggacaccccactt |
47464009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #157
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 47880185 - 47880226
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
47880185 |
tgcaggggccggggttcgaatcccggacaccccacttattca |
47880226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #158
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 1649191 - 1649272
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa---ggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| | |||||||||||| |||||||||||||||||| ||| || ||||||| |||||||||||||||| |||||| |
|
|
| T |
1649191 |
tgcaggggccagggttcgaaccctggacaccccacttattcaccttgaaaatggtgaat---tctagccactaggctatttgacc |
1649272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 218
Target Start/End: Original strand, 8859717 - 8859833
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa--ggtgaatttct |
199 |
Q |
| |
|
|||||||| |||| |||||| ||| | | |||||||| ||||||||||| ||||| ||| | ||||| |||||||||| ||| || |||||||| | |
|
|
| T |
8859717 |
tgagcttaactcaattggtagggaaattacataatatatgcaggggtcgatgttcgtacctcaaacacctcacttattcaccttaaaatggtgaatt--t |
8859814 |
T |
 |
| Q |
200 |
ctagccactaggctacttg |
218 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
8859815 |
ctagccactaggctacttg |
8859833 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 20103514 - 20103446
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| | || || ||||||||||||||| |||||| |
|
|
| T |
20103514 |
tgagcttaactcagttggtaaggacaatgcataatatttacaaggtccggggttcgaaccccagacacc |
20103446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 180
Target Start/End: Original strand, 23799339 - 23799379
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
23799339 |
tgcaggggtcgggattcgaacctcggacaccccacttattc |
23799379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 181
Target Start/End: Complemental strand, 25711206 - 25711146
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| || || || ||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
25711206 |
aggataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttattca |
25711146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 194
Target Start/End: Original strand, 25965743 - 25965838
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaa |
194 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||| | ||||||| | |||||| ||||||| |||| |||||||||| |||||||||||| |
|
|
| T |
25965743 |
ccatgagcttagctcacctggtaagggataatgcataatttatgcagggtttggggtttgaaccccagaca-cccacttatttgcctttaaggtgaa |
25965838 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #164
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 31475896 - 31475823
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||| || || ||||||| |||||||||||| |||| |
|
|
| T |
31475896 |
tgcaggggctggggttcgaacccctgacaccccacttattcactttaaaagtgaatt--tctagccactagactac |
31475823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #165
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 196
Target Start/End: Complemental strand, 35890941 - 35890889
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||| ||||||| |||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
35890941 |
gggtcggagttcgaatcccgaacaccccacttattcatcttataaggtgaatt |
35890889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #166
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 38025380 - 38025459
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| || |||||||||||| |||||| ||||||||||||||| |||||||||| |||||||||||||||| ||||| |
|
|
| T |
38025380 |
tgcaggagttggggttcgaacctcggacattccacttattcatcttataaggtgaat---cctagccactaggctacctgacc |
38025459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #167
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 38792251 - 38792322
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggct |
213 |
Q |
| |
|
|||||||||| | ||| ||||||||||||||| ||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
38792251 |
tgcaggggtcagagtttgaaccccggacaccctacttattcaccttataaggtgaat---tctagccactaggct |
38792322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #168
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 43119460 - 43119424
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
43119460 |
tgcaggggtcggggttcgaaccctggacaccccactt |
43119424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #169
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 46645738 - 46645786
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
46645738 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccact |
46645786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #170
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 46758271 - 46758319
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||| |||||||||||||| |
|
|
| T |
46758271 |
aatgcattttatatgcaggggtcggggttcgaactccggacaccccact |
46758319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #171
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 179
Target Start/End: Complemental strand, 2567888 - 2567849
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||| |
|
|
| T |
2567888 |
tgcaggggccggggttcgaaccccggtcaccccacttatt |
2567849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #172
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 123 - 196
Target Start/End: Complemental strand, 4042342 - 4042267
Alignment:
| Q |
123 |
ggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||| || || |||||||||||| |||||||| ||||||||| |||||||||| || ||||||||||| |
|
|
| T |
4042342 |
ggataatgcattattatatgcaggggtcggagttcgaacttcggacacccaacttattcattttataaggtgaatt |
4042267 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #173
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 4169115 - 4169193
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||| ||| ||| |||||| ||||||||||||| ||| |||| |
|
|
| T |
4169115 |
tgcaagggccggggtttgaaccccggacaccccacttattcaccttataaagtgaat---tctagccactaggttacctgac |
4169193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #174
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 181
Target Start/End: Original strand, 10958082 - 10958113
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
10958082 |
ggggttcgaaccccggacaccccacttattca |
10958113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #175
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 14818421 - 14818362
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| || || |||||||||| |
|
|
| T |
14818421 |
tgcaggggtcggggttcaaaccccaaacaccccacttattcactttaaaagtgaatttct |
14818362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #176
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 15265419 - 15265360
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||||||||||| |||||| |||||||||||||||| || || |||||||||| |
|
|
| T |
15265419 |
tgcaggggtcggggttcaaaccccaaacaccccacttattcactttaaaagtgaatttct |
15265360 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #177
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 152 - 199
Target Start/End: Original strand, 19126788 - 19126835
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
19126788 |
ggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
19126835 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #178
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 23274880 - 23274809
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| || | |||||| ||| | |||||||| | |||||||| ||| ||||||||||||||||||||| |
|
|
| T |
23274880 |
tgagcttagctaagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacacccca |
23274809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #179
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 29461881 - 29461807
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcgg-ggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||| |||||||||||| |||||||||||| |||||||| || ||||||||||||| |
|
|
| T |
29461881 |
tgagtttaactcagttggtagggacaatgcataatatatgcaggggtcggaggttcgaa-cctggacaccccactt |
29461807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #180
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 32984283 - 32984216
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| | |||| |||||||||| |||||||||||| |
|
|
| T |
32984283 |
tgagcttagctcagttggtagggatattgcatattatatacaggagtcggggttcaaaccccggacac |
32984216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #181
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 36932004 - 36932051
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36932004 |
tgcataatttatgcagggtccggggttcgaaccccggacaccccactt |
36932051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #182
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 37129412 - 37129342
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||| |||| ||||||||||||||||||| ||| |||||| ||| |||||||| |||||||| |
|
|
| T |
37129412 |
aggggtcggggttcaaacctcggacaccccacttattcaccttataaggtaaat---tctagccagtaggctac |
37129342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #183
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 89 - 176
Target Start/End: Complemental strand, 46534827 - 46534740
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| ||||||||||| |||| |||||| ||||| |||||| ||| |||||| | | | |||||||||||| |||| |||||| |
|
|
| T |
46534827 |
aaataaatccccatgagcttagctcagttggtagggatattgcatattatatgcaggagcctgagttcgaaccccgaacactccactt |
46534740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #184
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 99 - 196
Target Start/End: Original strand, 46716331 - 46716429
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| || |||| |||||| ||| ||||||| || || ||||| ||||||||||||||||| | |||||||||||||| | ||| ||||||||||| |
|
|
| T |
46716331 |
ccatgagcatagctcagttggta-ggacaatgcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatttaccttataaggtgaatt |
46716429 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 172
Target Start/End: Original strand, 12615755 - 12615825
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| ||||||||| ||| ||||||| ||||||||||| |
|
|
| T |
12615755 |
tgagcttaactcagttgatagggatattgcatattatatgcaggggttgggattcgaactccggacacccc |
12615825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 181
Target Start/End: Original strand, 16814739 - 16814777
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||| |
|
|
| T |
16814739 |
aggggtcggggttcgaaccccagacactccacttattca |
16814777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 170
Target Start/End: Original strand, 18714451 - 18714517
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||| |||| || |||||||| ||||||| ||||| |
|
|
| T |
18714451 |
agcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcaaaccccgtacacc |
18714517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 21066890 - 21066956
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| || ||||| |||||||||||||||||||| |
|
|
| T |
21066890 |
tgagtttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggaca |
21066956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 21105604 - 21105666
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || ||| ||||||||||||| |
|
|
| T |
21105604 |
tgagcttagctcagttggtatggaaaatgcataatatatgcaaggttcgaggttcgaaccccg |
21105666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 24061395 - 24061321
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| | ||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
24061395 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccgaacactccactt |
24061321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 25833559 - 25833633
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| || || |||||| |
|
|
| T |
25833559 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccactt |
25833633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 181
Target Start/End: Complemental strand, 26801786 - 26801716
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| |||||| | ||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |||| |
|
|
| T |
26801786 |
ctcagttggtaggaatattgcatattatatgcaggagccggggttcgaaccccggacactccacttcttca |
26801716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 27162361 - 27162299
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| ||| |||||||| || ||| ||| |||||||||||| |||||||||||| |
|
|
| T |
27162361 |
tgagcttaactcaattgttaaggatactgtatattatatgcaggggtcggagttcgaaccccg |
27162299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 27424843 - 27424917
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||||| |||||| ||| |||||||| ||||||||||||| |||| || |||||| |
|
|
| T |
27424843 |
tgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaacctcggatactccactt |
27424917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 28800083 - 28800013
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||| |||||||||| | |||||||| |||||| ||||||| |||||||||||| |
|
|
| T |
28800083 |
cttaactcagttggtagggacaatgcataatttatgcaggggcaggggtttgaacccctgacaccccactt |
28800013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 35815842 - 35815916
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| |||||||||||||||||||| ||| ||||| |||||| |
|
|
| T |
35815842 |
tgagcttagctcagttggtagggatatcgcattttatatgcaggggtcggggttcgaatcccagacactccactt |
35815916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 36469771 - 36469697
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||| || |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
36469771 |
tgagcttagctcagttggtagggatattacatattacatgcaggagccggggttcgaaccccggacactccactt |
36469697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 166
Target Start/End: Complemental strand, 36877048 - 36877014
Alignment:
| Q |
132 |
ataatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| |
|
|
| T |
36877048 |
ataatttgtgcaggggtcggggttcgaaccccgga |
36877014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 37411803 - 37411729
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||| | |||||||| | |||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
37411803 |
tgagtttagctcaattggtagggacattgcataatttatgcaggggtcggagtttgaactccggacaccccactt |
37411729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 40518951 - 40518881
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||| | |||||||||| || |||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
40518951 |
cttagctcagttggtagggacattgcataatatatgtaggggttgggattcgaactccggacaccccactt |
40518881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #201
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 180
Target Start/End: Original strand, 42352654 - 42352732
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
||||||| |||| |||||| ||| | ||| |||||| |||||||| | ||||| ||||||||||| |||||||||||| |
|
|
| T |
42352654 |
tgagctttgctcagttggtagggacattgcctaatatatgcaggggccagggtttgaaccccggacgccccacttattc |
42352732 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #202
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 215
Target Start/End: Original strand, 42887205 - 42887266
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| | ||| |||||||||| |||||||||||| |||| |
|
|
| T |
42887205 |
ggttcgaaccccggacaccccacttatttaccttataaggtgaat---tctagccactagactac |
42887266 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #203
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 167
Target Start/End: Complemental strand, 46570066 - 46570000
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggac |
167 |
Q |
| |
|
|||||||| |||| ||| ||||| |||||||||| | | |||||||| ||||||||||||||||||| |
|
|
| T |
46570066 |
tgagcttagctcacttgataagggataatgcatagtttatgcaggggccggggttcgaaccccggac |
46570000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #204
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 182
Target Start/End: Original strand, 47355848 - 47355890
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||||||| ||||||||||||||| |||| ||||||||||||| |
|
|
| T |
47355848 |
tgcaggggccggggttcgaaccccagacatcccacttattcat |
47355890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #205
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 47635092 - 47635166
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| |||||||||||||| |||||||| || ||||||| |||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
47635092 |
agggatcggggttcgaacctcggacacctcatttattca-ctttaaaatgaatt--tctagccactaggctacctgac |
47635166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #206
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 47641049 - 47641123
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||||| |||||||||||||| ||||| |||||| |
|
|
| T |
47641049 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggctggggttcgaaccccagacactccactt |
47641123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #207
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 142 - 180
Target Start/End: Original strand, 48175008 - 48175046
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
48175008 |
caggggccggtgttcgaaccccggacaccccacttattc |
48175046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #208
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 96 - 170
Target Start/End: Original strand, 48527185 - 48527259
Alignment:
| Q |
96 |
tcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||| ||||||||||||| ||| |||||| |||||||||||| |||| || ||| ||||||| ||||| |||| |
|
|
| T |
48527185 |
tcaccgtgagcttatctcagttgataaggacaatgcataatatatgcaaggtccggagttcgaatcccggccacc |
48527259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #209
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 48674628 - 48674554
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| ||| |||||||| ||||| ||| ||||||||| ||||||| |||||||||||| |||||| |
|
|
| T |
48674628 |
tgagtttaactcagttgataaggatattgcattttatatgcaggggttggggttcaaaccccggacactccactt |
48674554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #210
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 180
Target Start/End: Complemental strand, 924345 - 924308
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
924345 |
aggggttggggttcgaaccccagacaccccacttattc |
924308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #211
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 169
Target Start/End: Original strand, 7525462 - 7525515
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||||||| |||||| ||| ||||||||||| |||||||| |||||||| |
|
|
| T |
7525462 |
ttggtaaggatattgcatattatatgcaggggtcgaggttcgaattccggacac |
7525515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #212
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 101 - 197
Target Start/End: Complemental strand, 8133891 - 8133794
Alignment:
| Q |
101 |
atgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||| |||| ||| ||| |||||||||||||| | |||||||| || |||||||| || ||||||||| | ||| ||||||||||||||| |
|
|
| T |
8133891 |
atgagcttagctcacttgataatggataatgcataatttatgcaggggccgaagttcgaactccagacaccccattaatttgcctttaaggtgaattt |
8133794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #213
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 8724419 - 8724476
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||||||| ||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
8724419 |
tgcagaggtcgggaatcgaacctcggacaccccacttattcaccttataaggtgaatt |
8724476 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #214
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 10690872 - 10690925
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| |||||||||||| ||||||||||| ||||||||||| |
|
|
| T |
10690872 |
ggatattgcatattatatgcaggggtcggagttcgaaccccaaacaccccactt |
10690925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #215
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 175
Target Start/End: Original strand, 13702025 - 13702102
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||||||| |||| |||||| ||| || ||||| ||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
13702025 |
ccatgagctttgctcagttggtagggacaaatgcattttatatgcaggggccggggttcaaaccccggacaccccact |
13702102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #216
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 13720795 - 13720848
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| |||||||| |||||||||||||||| |||| |||||| |
|
|
| T |
13720795 |
ggatattgcatattatatgcaggggccggggttcgaaccccgaacactccactt |
13720848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #217
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 20101693 - 20101644
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||||| |||||||||||| |||||||||| |||| |
|
|
| T |
20101693 |
aatgcatattatatgcaggggccggggttcgaactccggacaccctactt |
20101644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #218
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 24304339 - 24304298
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||| ||| |||||||| ||||||| |
|
|
| T |
24304339 |
tgcaggggtcggggttcgaactccgaacaccccatttattca |
24304298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #219
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 27047771 - 27047730
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||| ||||||| |
|
|
| T |
27047771 |
tgcaggggccggggttcgaacctcggacaccccatttattca |
27047730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #220
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 161
Target Start/End: Original strand, 27633949 - 27633994
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaacc |
161 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||||||||||||||| |
|
|
| T |
27633949 |
ttggtagggatattgcatattatatgcaggggtcggggttcgaacc |
27633994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #221
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 125 - 174
Target Start/End: Complemental strand, 29339461 - 29339412
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||||| ||||||| ||||||||||| |||||||||||| ||||||||| |
|
|
| T |
29339461 |
ataatgtataatatatgcaggggtcgaggttcgaaccccaaacaccccac |
29339412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #222
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 169
Target Start/End: Complemental strand, 31769564 - 31769511
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||| ||||||||||||||||| ||||| |
|
|
| T |
31769564 |
ttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacac |
31769511 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #223
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 32047114 - 32047167
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| ||||| ||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32047114 |
ggatattgcatgttatatgcaggggccggggttcgaaccccggacacctcactt |
32047167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #224
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 34891235 - 34891284
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
34891235 |
aatgcattttatatgcaggggccggggttcgaactccggacaccccactt |
34891284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #225
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 35195882 - 35195923
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
35195882 |
tgcaggggccggggttcgaaccccgaacaccccatttattca |
35195923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #226
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 35645600 - 35645677
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || |||| |||||| ||||| || ||| ||| |||||| | |||||||||||||| |||||| |||||| |
|
|
| T |
35645600 |
ccatgagcgtagctcagttggtagggatattgtatattatatgcaggagccggggttcgaaccctggacactccactt |
35645677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #227
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 41913829 - 41913756
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| ||| || |||| ||||| ||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
41913829 |
gagcttagctcagttgatagagatattgcattttatatgcaggggtcagggttcgaaccccggacactccactt |
41913756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #228
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 3532596 - 3532656
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||||||| |||||||| || |||||||||||| |||| |||||| |
|
|
| T |
3532596 |
ttggtagggatattgcataatatatgcaggggccgaggttcgaaccccaaacactccactt |
3532656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #229
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 160
Target Start/End: Complemental strand, 6567455 - 6567399
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||||| |||| |||||||||||| | |||||||| ||||| |||||||||||||| |
|
|
| T |
6567455 |
agcttaactcagttggtaaggatattacataatatatgcagaagtcggggttcgaac |
6567399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #230
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 123 - 183
Target Start/End: Original strand, 7057228 - 7057288
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatc |
183 |
Q |
| |
|
||||||| |||||||||||||||||| | |||| |||| | ||||| ||||||||||||| |
|
|
| T |
7057228 |
ggataatacataatatgtgcaggggttagagttcaaacctcagacactccacttattcatc |
7057288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #231
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 7872804 - 7872740
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||| |||| || ||||||||||||| ||||||| |
|
|
| T |
7872804 |
cttagctcagttggtaaggacaatgcataatatatgcaaggtctggggttcgaacccaggacacc |
7872740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #232
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 8725185 - 8725153
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||| |
|
|
| T |
8725185 |
cggggttcgaaccccgaacaccccacttattca |
8725153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #233
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 9929968 - 9929896
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| || ||| ||| ||||| |||||| |||||||||||||| || |||||| |
|
|
| T |
9929968 |
agcttagctcagttggtagggatattgaatattatatgcagcggtcggtgttcgaaccccggatactccactt |
9929896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #234
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 173
Target Start/End: Original strand, 9992610 - 9992682
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||||| || | || || | ||||||||||||||||| |||||||| |
|
|
| T |
9992610 |
tgagcttagctcatttgataagggataatgcattatgtatgtagagatcggggttcgaaccccgaacacccca |
9992682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #235
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 10236965 - 10236897
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| ||| |||| |||||||| | |||||||||| | |||| || ||| ||||||||||||||||||| |
|
|
| T |
10236965 |
tgagtttaactcagttggtaagaacaatgcataatgtatgcaaggttcgaggttcgaaccccggacacc |
10236897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #236
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 14046671 - 14046603
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||||||||||| |||||| || ||||||||||||| |||| | |||||||| |||||||| |||| |
|
|
| T |
14046671 |
tgagcttatctcagttggtatgggtaatgcataatatatgcaagatacggggttcaaaccccggccacc |
14046603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #237
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 14356701 - 14356633
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||||||||||| |||||| || ||||||||||||| |||| | |||||||| |||||||| |||| |
|
|
| T |
14356701 |
tgagcttatctcagttggtatgggtaatgcataatatatgcaagatacggggttcaaaccccggccacc |
14356633 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #238
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 163
Target Start/End: Original strand, 15655705 - 15655769
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
||||||||||| |||| |||||| ||||| ||||| ||| ||||||| ||||||||||||||| |
|
|
| T |
15655705 |
ccatgagcttagctcaattggtagggatattgcattttatatgcagggagcggggttcgaacccc |
15655769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #239
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 17997783 - 17997716
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| |||||||||| ||||||| ||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
17997783 |
gggttcgaaccctggacaccccatttattcaccttaaaaggtgaat---tctagccactagactacttgac |
17997716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #240
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 21322176 - 21322244
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||| | |||| || | |||||| |||||||| |||| |
|
|
| T |
21322176 |
tgagcttaactcagttggtaaggataatgcataatgtatgcaaggtccagggttcaaaccccggccacc |
21322244 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #241
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 24880516 - 24880444
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| || ||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
24880516 |
agcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccgaacactccactt |
24880444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #242
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 24991782 - 24991850
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| | |||| ||||||| ||||||||| |
|
|
| T |
24991782 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaagatacgggattcgaactccggacacc |
24991850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #243
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 25965165 - 25965129
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
25965165 |
tttaaggtgaatttctctaaccactaggctatttgac |
25965129 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #244
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 28693885 - 28693853
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| |
|
|
| T |
28693885 |
cggggttcgaaccccggacaccctacttattca |
28693853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #245
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 138
Target Start/End: Complemental strand, 34607047 - 34607011
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatat |
138 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||||| |
|
|
| T |
34607047 |
tgagcttatctcagttggtaaagataatgcataatat |
34607011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #246
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 36388600 - 36388636
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
36388600 |
tttaaggtgaatttctctaaccactaggctatttgac |
36388636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #247
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 38110226 - 38110162
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
||||||||| || |||| ||||| |||| ||||||| ||||||||||||| |||||||| |||| |
|
|
| T |
38110226 |
gttcgaacctcgaacactccactatttcacctttaagatgaatttctctagtcactaggccactt |
38110162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #248
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 41833012 - 41832976
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
41833012 |
tgcaggggccggggttcgaaccctggacaccccactt |
41832976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #249
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 142 - 178
Target Start/End: Complemental strand, 43712367 - 43712331
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||||||||||||||| |||| ||||||||||| |
|
|
| T |
43712367 |
caggggtcggggttcgaacctcggataccccacttat |
43712331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #250
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 197
Target Start/End: Complemental strand, 45723920 - 45723868
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| |||||||| || || |||||||||||| | ||||||||||||||| |
|
|
| T |
45723920 |
gggtcggtgttcgaactccagataccccacttatttacctttaaggtgaattt |
45723868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #251
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 46337924 - 46337845
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggaca-ccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| ||||||||||||||| ||||| ||||||||||||| ||| ||| ||||| ||||||||||||||||| |||| |
|
|
| T |
46337924 |
tgcagggatcggggttcgaaccctggacacccccacttattcaccttataaattgaat---tctagccactaggctacctgac |
46337845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #252
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 170
Target Start/End: Original strand, 48837872 - 48837936
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| |||||| |||||||||||||||| |||| | | |||||||||||||||| |||| |
|
|
| T |
48837872 |
cttaactcaattggtatggataatgcataatatatgcaaagtttggggttcgaaccccggccacc |
48837936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 100; Significance: 2e-49; HSPs: 287)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 47864633 - 47864756
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47864633 |
ccataagcttagctcatttggtaagggataatgcacaatatgtgcaggggttggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
47864732 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
47864733 |
ctctagccactaggctacttgacc |
47864756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 33528303 - 33528180
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| |||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33528303 |
ccatgagcttagctcatttggtaagggataatgcacaatttgtgcaggggctggggttcgaaccccagacaccccacttattcatctttaaggtgaattt |
33528204 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
33528203 |
ctctagccactaggctacttgacc |
33528180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 92; E-Value: 9e-45
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 50381711 - 50381834
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||| |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50381711 |
ccatgagcttaactcatttggtaagggataatgcacaatatatgcaggggtcggggttcgaatcccggacaccccacttattcatctttaaggtgaattt |
50381810 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| |||||| ||||||| |
|
|
| T |
50381811 |
ctctagccattaggctgcttgacc |
50381834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 91; E-Value: 4e-44
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 39739271 - 39739393
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||| | ||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
39739271 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcagggattggggttcgaaccccggacacctcacttattcatctttaaggtgaattt |
39739370 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
39739371 |
ctctagccactagactacttgac |
39739393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 11483610 - 11483733
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| | |||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
11483610 |
ccatgagcttagctcatttggtaagggataatgcaaaatatgtgcaggggccagggttcgaactccggacaccccacttattcatctttaaggtgaattt |
11483709 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||| ||||| |||||||||| |
|
|
| T |
11483710 |
ctctagcaactagactacttgacc |
11483733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 111 - 220
Target Start/End: Original strand, 27471513 - 27471623
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||||| |||||||||||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
27471513 |
ctcatttggtaagggataatgcataatatgtacaggggttggggttcgaaccccggacaccccacttattcatctttaaggtaaatttctctagccacta |
27471612 |
T |
 |
| Q |
210 |
ggctacttgac |
220 |
Q |
| |
|
| ||||||||| |
|
|
| T |
27471613 |
gactacttgac |
27471623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 133 - 220
Target Start/End: Complemental strand, 29645890 - 29645803
Alignment:
| Q |
133 |
taatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
29645890 |
taatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactagactacttgac |
29645803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 46798579 - 46798702
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||| ||| |||||||| |||||||||||||| |||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
46798579 |
ccatgagcttaactcatttggtgagggataatgcacaatatgtgcaggggccgggattcgaaccctggacaccccacttattcatctttaaggtagattt |
46798678 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||||||||||||| |
|
|
| T |
46798679 |
ctctaaccactaggctacttgacc |
46798702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 55426111 - 55426230
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||||| ||| || |||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
55426111 |
ccatgagcttagctcatttggtaaaggataatgcacaatatgtgcatgggccgaggttcgaaccccggacaccccact----catctttaaggtgaattt |
55426206 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
55426207 |
ctctagccactaggctacttgacc |
55426230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 25165437 - 25165564
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggaca-ccccacttattcatc---tttaaggtga |
193 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||| |||||||||||||||||||| ||||||||||||||| |||||||||| |
|
|
| T |
25165437 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcagggaccggggttcgaaccccggacacccccacttattcatcttttttaaggtga |
25165536 |
T |
 |
| Q |
194 |
atttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||| ||||||| |
|
|
| T |
25165537 |
atttctctagccactaggctgcttgacc |
25165564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 27817163 - 27817044
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| |||||||||| ||| |||||||||| |||||||||| ||||||||||||||| ||||||||| |
|
|
| T |
27817163 |
atgagcttacctcatttggtaagggataatgcacaatttgtgcaggggccggagttcgaaccc-ggacaccccatttattcatctttaagttgaatttct |
27817065 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
27817064 |
ctagccactaggctacttgac |
27817044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 32421345 - 32421467
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||||||||| |||||||||||||||||||||| || || ||||||||||||||||||||| ||||||| |
|
|
| T |
32421345 |
ccatgagcttagctcatctggtaagggataatgcataatatatgcaggggtcggggttcgaacctcgaactccccacttattcatctttaagatgaattt |
32421444 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
32421445 |
ttctagccactaaactacttgac |
32421467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 123 - 220
Target Start/End: Complemental strand, 31435574 - 31435477
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| |||||||| |||||| |||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
31435574 |
ggataatgcacaatatgtgtaggggttggggttcgaacctcggacatcccacttattcatctttaaggtgaatttctctagccactagactacttgac |
31435477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 99 - 202
Target Start/End: Original strand, 29226323 - 29226427
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||| || |||||||||||||| |||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
29226323 |
ccatgagcttagctcatttggtaagggataacacacaatatgtgcaggggccggggttcgaaccccgtacaccccacttattcatctttaaggtgaattt |
29226422 |
T |
 |
| Q |
198 |
ctcta |
202 |
Q |
| |
|
||||| |
|
|
| T |
29226423 |
ctcta |
29226427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 46247257 - 46247382
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca---cttattcatctttaaggtgaa |
194 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| |||||||||| |||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
46247257 |
ccatgagcttagctcatttggtaagggataatgcacaatttgtgcaggggctggggttcgaaccccagacaccccacttcttattcatctttaaggtgaa |
46247356 |
T |
 |
| Q |
195 |
tttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||| ||||||||||||||||||| |
|
|
| T |
46247357 |
tttctct-gccactaggctacttgacc |
46247382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 111 - 221
Target Start/End: Complemental strand, 22602289 - 22602178
Alignment:
| Q |
111 |
ctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
||||||||||||||| ||||||| |||||||| ||||| || |||||||| ||| |||| | |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22602289 |
ctcatttggtaaggaataatgcacaatatgtgtaggggacgaggttcgaatcccagacatcgcacttattcatctttaaggtgaatttctctagccacta |
22602190 |
T |
 |
| Q |
210 |
ggctacttgacc |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
22602189 |
ggctacttgacc |
22602178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 99 - 217
Target Start/End: Original strand, 45431624 - 45431743
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||| ||||||||| ||||||| || | | |||||||||| ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
45431624 |
ccatgagcttagctcacttggtaagggataatgcgtattttatgcaggggtcagggttcgaaccccggacaccccacttattcacctttaaggtgaattt |
45431723 |
T |
 |
| Q |
198 |
ctctagccactaggctactt |
217 |
Q |
| |
|
| |||||| ||||||||||| |
|
|
| T |
45431724 |
ccctagccgctaggctactt |
45431743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 166788 - 166908
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||||| | |||||||| ||||||||||||||| |||||| |||||||||| |||||| |||||||||| |
|
|
| T |
166788 |
tgagcttagctcacttggtaagggataatgcataatttatgcaggggccggggttcgaaccccagacacctcacttattcacctttaaagtgaatttctt |
166887 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
||||| ||||||||||||||| |
|
|
| T |
166888 |
tagccgctaggctacttgacc |
166908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 124 - 220
Target Start/End: Complemental strand, 44062113 - 44062018
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||||||| ||| |||||||||||| |||||||||||||||||||||||||||||| |||||||||||||| ||||||||| |
|
|
| T |
44062113 |
gataatgcacaatatgtgcaggggccggagttcgaaccccg-acaccccacttattcatctttaaggtgaatgtctctagccactagactacttgac |
44062018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 1102769 - 1102671
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||| | |||||||| ||| ||||||||| |||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
1102769 |
ggataatgcataatttatgcaggggacggagttcgaaccatggacaccccacttattcacctttaaggtgaatttctctagccgctaggctacttgacc |
1102671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 9321057 - 9320935
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||| ||||| |||||| | ||| ||||||||||| |||||||||| |||| |||||||||||||||||||| ||| ||||||| |
|
|
| T |
9321057 |
ccatgagtttagctcatttgataagggataatgtacaatttgtgcaggggttggggttcgaaacccgaacaccccacttattcatcttaaagatgaattt |
9320958 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||||||||||||| |
|
|
| T |
9320957 |
ctctaaccactaggctacttgac |
9320935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 27394508 - 27394626
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||| | |||| ||||||||| ||||||||| ||| |||||||| |||||| ||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
27394508 |
tgagctaagctcacttggtaagggataatgcatt-tatatgcaggggctggggtttgaaccccggacaccccacttattcacctttaaggtgaatttctc |
27394606 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
27394607 |
tagccgctaggctacttgac |
27394626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 30162654 - 30162780
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc-----cggacaccccacttattcatctttaaggtg |
192 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||| ||| |||||||||||||| |||||||| ||||||||||| ||||||||| |
|
|
| T |
30162654 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaagggccggggttcgaacccgggcacggacacctcacttattcat-tttaaggtg |
30162752 |
T |
 |
| Q |
193 |
aatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||||||||| ||||| |
|
|
| T |
30162753 |
aatttctctagcaactaggctatttgac |
30162780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 38668137 - 38668248
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||| |||||| || ||| || ||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38668137 |
ctcatttggtaagggataatgcacaatacgtgtaggggttggagttgaaatccctgacaccccacttattcatctttaaggtgaatttctctagccacta |
38668236 |
T |
 |
| Q |
210 |
ggctacttgacc |
221 |
Q |
| |
|
| |||||||||| |
|
|
| T |
38668237 |
gactacttgacc |
38668248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 49429458 - 49429580
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| | | ||||||| | ||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
49429458 |
ccatgagcttaactcatttggtaagggataatgcatt-tgtatgcagggaccagggttcgaaccccggacaccccacttattcacctttaaggtgaattt |
49429556 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| |||| |||||| |
|
|
| T |
49429557 |
ctctagccgctaagctatttgacc |
49429580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 986017 - 985895
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||| ||||| || ||||||||||| |||||||| ||| |||||||||| ||||| ||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
986017 |
ccatgtgcttaacttatttggtaaggcataatgcacaatttgtgcaggggctggggtctgaatcccggacaccccacttattcatcttaaaggtgaattt |
985918 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| |||||||| |
|
|
| T |
985917 |
ctctagccactagattacttgac |
985895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 50676965 - 50676843
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||| ||||||||| | ||| |||| ||| || |||||| ||||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
50676965 |
ccatgagtttaactcacttggtaagggacaatacatattatatgtaggggttggggttcgaaccccgaacaccccacttattcacctttaaggtgaattt |
50676866 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||| ||||||||| |
|
|
| T |
50676865 |
ctctaaccactagactacttgac |
50676843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 94 - 220
Target Start/End: Original strand, 7517932 - 7518059
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtg |
192 |
Q |
| |
|
|||| |||| |||||| |||||||||||||| ||| |||| ||| |||||||| | || ||||||||||||| ||||||||||||| |||||| || ||| |
|
|
| T |
7517932 |
aatccccattagcttagctcatttggtaagggatattgcacaatttgtgcaggagccgcggttcgaaccccgaacaccccacttatccatcttaaaagtg |
7518031 |
T |
 |
| Q |
193 |
aatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |
|
|
| T |
7518032 |
aattcctctagccattaggctacttgac |
7518059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 50271727 - 50271848
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||| | | |||||||| || ||||||||||||| ||| |||||||||||| ||||||||||||||| |
|
|
| T |
50271727 |
ccatgagcttagctcatttggtaagagataatgcatt-tgtatgcaggggccgtggttcgaaccccgtacatcccacttattcacctttaaggtgaattt |
50271825 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| || |||| ||||||||| |
|
|
| T |
50271826 |
ctctaaccgctagactacttgac |
50271848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 38414905 - 38415002
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||| |||||||||| ||||| |||| | | |||||||||||||||| ||||||||||||||||||| ||| |||||||||||||| |
|
|
| T |
38414905 |
ggataatgcatattatatgcaggggtcagggtttgaactctgaacaccccacttattcacctttaaggtgaatttctctggccgctaggctacttgac |
38415002 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 114 - 220
Target Start/End: Complemental strand, 1325415 - 1325307
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc-acttattcatctttaaggtgaatttctctagccactagg |
211 |
Q |
| |
|
||||||||||| |||||||| ||||| | ||||| ||||| ||||||||||||||||||| | ||||||||||||||| ||||||||| |||||||||| |
|
|
| T |
1325415 |
atttggtaagggataatgcacaatatatacagggatcgggattcgaaccccggacacccccatttattcatctttaagatgaatttctttagccactaga |
1325316 |
T |
 |
| Q |
212 |
ctacttgac |
220 |
Q |
| |
|
||||||||| |
|
|
| T |
1325315 |
ctacttgac |
1325307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 99 - 206
Target Start/End: Original strand, 2259154 - 2259261
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||| |||| |||||| |||| || ||||||||||||||||||| ||||| |
|
|
| T |
2259154 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggagttcaaaccccagaca-cctacttattcatctttaaggtaaattt |
2259252 |
T |
 |
| Q |
198 |
ctctagcca |
206 |
Q |
| |
|
|||||||| |
|
|
| T |
2259253 |
atctagcca |
2259261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 16141451 - 16141328
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||||| || ||||||| ||||| |||||||| ||||||| || ||| ||||||||||| || ||||||||||||||||||||| ||||| ||||| |
|
|
| T |
16141451 |
ccatgagcatagttcatttgataagggataatgcacaatatgtacaagggctggggttcgaactccagacaccccacttattcatcttaaaggtaaattt |
16141352 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| |||||||||||||||||| |
|
|
| T |
16141351 |
atctaaccactaggctacttgacc |
16141328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 54457153 - 54457272
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||| |||| ||||||||||||| | || ||| | |||||| |||||||||||||||| ||||||| |||||||||||||||||| |
|
|
| T |
54457153 |
tgagcttaactcacttgataagagataatgcataatttatgtaggagctggggtttaaaccccggacaccccatttattcacctttaaggtgaatttctc |
54457252 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||||||||||| |
|
|
| T |
54457253 |
tagccgctaggctacttgac |
54457272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 36590387 - 36590514
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccgg------acaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||| | |||||||||||||| || |||||||||||||| ||||| ||||||||||| |||||||| |
|
|
| T |
36590387 |
ccatgagattagctcatttggtaagggataatgtacaatatgtgcaggggccgtggttcgaaccccgggcacggacacctcacttattcat-tttaaggt |
36590485 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||| ||||| |
|
|
| T |
36590486 |
gaatttctctagccactagactatttgac |
36590514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 111 - 219
Target Start/End: Original strand, 48717422 - 48717531
Alignment:
| Q |
111 |
ctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
||||||||||||||| |||| ||| || | ||||||||| |||||||||||||| ||||||||||| ||||||||||||||||||||||| |||| ||| |
|
|
| T |
48717422 |
ctcatttggtaaggaataatacattatgtatgcaggggtaggggttcgaaccccaaacaccccactttttcatctttaaggtgaatttctccagccgcta |
48717521 |
T |
 |
| Q |
210 |
ggctacttga |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
48717522 |
aactacttga |
48717531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 123 - 202
Target Start/End: Original strand, 50688862 - 50688941
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||||||| ||||| | ||||||||||||||||||| ||||||||||||| |
|
|
| T |
50688862 |
ggataatgcataatacgtgcaggagtcggggttcgaattccggatatcccacttattcatctttaaagtgaatttctcta |
50688941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 123 - 217
Target Start/End: Complemental strand, 37756486 - 37756392
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||||| | |||||||| |||||||||||||| |||||||||||||||| |||||| |||| ||||||| ||| ||||||||||| |
|
|
| T |
37756486 |
ggataatgcataatttatgcaggggctggggttcgaaccccaaacaccccacttattcacctttaacgtgagtttctctcgccgctaggctactt |
37756392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 89 - 220
Target Start/End: Complemental strand, 1084136 - 1084011
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta |
187 |
Q |
| |
|
|||||| || ||||||||||| |||||||| ||| |||||||| | ||||||||||||||| |||||||||||||||| |||| ||||||||||| |
|
|
| T |
1084136 |
aaatcagtccccatgagcttagctcatttgttaaaggataatgtacaatatgtgcaggggt------tcgaaccccggacacctcact-attcatcttta |
1084044 |
T |
 |
| Q |
188 |
aggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
| ||||||||| ||||||||||||||||||| |
|
|
| T |
1084043 |
aagtgaatttcgtcagccactaggctacttgac |
1084011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 160 - 221
Target Start/End: Complemental strand, 8931013 - 8930952
Alignment:
| Q |
160 |
ccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||| |||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
8931013 |
ccccggacaccccacttattcacctttaaagtgaatttctctagccgctaggctacttgacc |
8930952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 123 - 199
Target Start/End: Original strand, 24559410 - 24559487
Alignment:
| Q |
123 |
ggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||||||| || |||||||||||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
24559410 |
ggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
24559487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 46328980 - 46328901
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
46328980 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
46328901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 213
Target Start/End: Complemental strand, 28054815 - 28054713
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||| ||||||||| ||| |||||||| | |||||||||| | ||||||||||| ||||||||||||||| ||| |||||||||| |||||||||| ||| |
|
|
| T |
28054815 |
ctcacttggtaagggatattgcataatttatgcaggggtcagagttcgaaccccagacaccccacttatttatccttaaggtgaa-ttctctagccgcta |
28054717 |
T |
 |
| Q |
210 |
ggct |
213 |
Q |
| |
|
|||| |
|
|
| T |
28054716 |
ggct |
28054713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 213
Target Start/End: Complemental strand, 28065240 - 28065138
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||| ||||||||| ||| |||||||| | |||||||||| | ||||||||||| ||||||||||||||| ||| |||||||||| |||||||||| ||| |
|
|
| T |
28065240 |
ctcacttggtaagggatattgcataatttatgcaggggtcagagttcgaaccccagacaccccacttatttatccttaaggtgaa-ttctctagccgcta |
28065142 |
T |
 |
| Q |
210 |
ggct |
213 |
Q |
| |
|
|||| |
|
|
| T |
28065141 |
ggct |
28065138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 27183737 - 27183658
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
27183737 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
27183658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 30779633 - 30779559
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
30779633 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctggacaccccactt |
30779559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 45118641 - 45118762
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta--aggtgaatt |
196 |
Q |
| |
|
||||||||||| |||| |||||| ||| | ||||| |||| |||||||| |||||||||||||| ||| ||||||||||||| ||||| ||||||||| |
|
|
| T |
45118641 |
ccatgagcttagctcagttggtagggacattgcattatatatgcaggggccggggttcgaacccgggattccccacttattca-ctttaagaggtgaatt |
45118739 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||| |||| |
|
|
| T |
45118740 |
--tctagccactaggctactcgacc |
45118762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 25884029 - 25883980
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25884029 |
aatgcataatatatgcaggggtcggggttcgaaccccggacaccccactt |
25883980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 31586948 - 31587025
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| |||||| ||| |||||||||||| ||||||| |||||||||||||||| |
|
|
| T |
31586948 |
ccatgagcttagctcagttggtagggatattgcatattatatgcaggggtcggagttcgaatcccggacaccccactt |
31587025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 36763433 - 36763552
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttt---aaggtgaatttc |
198 |
Q |
| |
|
||||||| |||| |||||| ||| | |||||||||| |||||||| ||| ||| |||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
36763433 |
tgagcttggctcagttggtagggacattgcataatatatgcaggggccggagtttgaaccc-ggacaccccacttattcatctttaaaaaggtgaatt-- |
36763529 |
T |
 |
| Q |
199 |
tctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
36763530 |
tctagccactagactacttgacc |
36763552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 96 - 176
Target Start/End: Complemental strand, 46336575 - 46336494
Alignment:
| Q |
96 |
tcaccatgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||||| |||| |||||| |||||| | |||||||| ||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
46336575 |
tcaccgtgagcttagctcagttggtagggataaatacataatatatgcaggggtcggggttcgaaccccgaacaccccactt |
46336494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 217
Target Start/End: Complemental strand, 23651165 - 23651049
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||| | || |||| |||||||||| |||||| |||||||||||| ||||| |||||||| || |
|
|
| T |
23651165 |
tgagcttaactcatttgataagagataatgcataatatatatagaagtcgaggttcgaacctcggacatcccacttattcacatttaaagtgaatttatc |
23651066 |
T |
 |
| Q |
201 |
tagccactaggctactt |
217 |
Q |
| |
|
||||| |||||||||| |
|
|
| T |
23651065 |
tagcccttaggctactt |
23651049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 23653282 - 23653206
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||| |||||||| | | |||||||||| ||||||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
23653282 |
tgagcttaactcagttggtaagaacattgcataatatatgcaggggtcggggttcgaaccccgaacacctcacttat |
23653206 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 122 - 196
Target Start/End: Complemental strand, 32508869 - 32508793
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
32508869 |
aggataatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataaggtgaatt |
32508793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 33206796 - 33206875
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
33206796 |
tgcaggggctggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
33206875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 41936471 - 41936399
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
41936471 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
41936399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 43566852 - 43566773
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||| | ||||||||||||||||| ||| |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
43566852 |
tgcaggggtcggggttcgaacctcagacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgacc |
43566773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 153 - 221
Target Start/End: Original strand, 43897654 - 43897722
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| | ||||||||||||||||| |||||||||||||||||||| || |||||||||||||| |
|
|
| T |
43897654 |
gttcgaacctcagacaccccacttattcacctttaaggtgaatttctctaaccgttaggctacttgacc |
43897722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 49146085 - 49146164
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||| || || |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49146085 |
tgagcttaactcagttggta-ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattca |
49146164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 99 - 169
Target Start/End: Original strand, 8258149 - 8258220
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||||||||| |||||||||||| || ||||||| |||||||||||||||||| |||||||||||| |||| |
|
|
| T |
8258149 |
ccatgagcttaactcatttggtaatggttaatgcacaatatgtgcaggggtcggagttcgaaccccgaacac |
8258220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 93 - 176
Target Start/End: Complemental strand, 34102686 - 34102603
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| ||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34102686 |
caatccccgtgagcttagttcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
34102603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 99 - 200
Target Start/End: Original strand, 34225192 - 34225296
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccg---gacaccccacttattcatctttaaggtgaa |
194 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||||||||| | | ||| ||||||| |||||| |||||||||| |||||||||||| |
|
|
| T |
34225192 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcagggg-ctagattcaaaccccggacgacacctcacttattcacctttaaggtgaa |
34225290 |
T |
 |
| Q |
195 |
tttctc |
200 |
Q |
| |
|
|||||| |
|
|
| T |
34225291 |
tttctc |
34225296 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 43774224 - 43774302
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| ||| |||||||||| ||||||||||||| ||| |||| |
|
|
| T |
43774224 |
tgcaggggtcggggttcgaaccccagacaccccacttattcaccttataaggtgaat---tctagccactaggttacctgac |
43774302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 9625022 - 9625101
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| |||||||||||| |||| ||||| |
|
|
| T |
9625022 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactagactacctgacc |
9625101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 29373515 - 29373441
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||| ||| |||||||| ||||||||||||| | |||||||||||| |
|
|
| T |
29373515 |
tgagcttaactcagttggtaaggatattgcatattatatgcaggggccggggttcgaacctcagacaccccactt |
29373441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 199
Target Start/End: Original strand, 31419583 - 31419681
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| |||||||||||||| | || ||| |||||||| ||||| |||||||||||||| |||||||||||||||| ||| || |||||||||| |
|
|
| T |
31419583 |
tgagcttaactcatttggtaagggacaacgcacaatatgtgtaggggctggggttcgaaccccaaacaccccacttattcaccttaaaagtgaatttct |
31419681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 32256620 - 32256546
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
32256620 |
tgagcttagctcagttggtagggatattgcatgttatatgcaggggccggggttcgaaccccggacaccccactt |
32256546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 39719939 - 39720013
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
39719939 |
tgagtttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
39720013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 52309176 - 52309102
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||| |||||||||||| |
|
|
| T |
52309176 |
tgagcttaactcagttggtagggatattgcatactatatgcaggagtcggggttcgaaccccagacaccccactt |
52309102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 53163598 - 53163672
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
53163598 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccccggacaccccactt |
53163672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 53432803 - 53432729
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
53432803 |
tgagtttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
53432729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 135 - 196
Target Start/End: Complemental strand, 54983766 - 54983704
Alignment:
| Q |
135 |
atatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
54983766 |
atatatgcaggggtcggggttcgaaccccggacaccccatttattcaccttataaggtgaatt |
54983704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 24537866 - 24537923
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
24537866 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
24537923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 219
Target Start/End: Complemental strand, 33830454 - 33830345
Alignment:
| Q |
111 |
ctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
||||||||||||| ||||||||| ||||| |||||||| ||| |||| || |||||||||||||||||| ||||||||||||||||||| ||| || |
|
|
| T |
33830454 |
ctcatttggtaagagataatgcacaatatatgcaggggctctagtttgaactccagacaccccacttattcatttttaaggtgaatttctctaaccaata |
33830355 |
T |
 |
| Q |
210 |
ggctacttga |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
33830354 |
aactacttga |
33830345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 36331782 - 36331741
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36331782 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
36331741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 102 - 194
Target Start/End: Complemental strand, 37134005 - 37133912
Alignment:
| Q |
102 |
tgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaa |
194 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||| ||| | |||| ||| | |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37134005 |
tgagcttagctcacttggtaaaggataatgcatgttatatacaggagtcagagttcaaactccggacaccccacttattcatctttaaggtgaa |
37133912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 106 - 178
Target Start/End: Complemental strand, 38869282 - 38869209
Alignment:
| Q |
106 |
cttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||| |||| ||||||||| ||||||||||||| ||||||||||||||||||||||||| |||| |||||||| |
|
|
| T |
38869282 |
cttaactcacttggtaagggataatgcataatacatgcaggggtcggggttcgaaccccgaacacgccacttat |
38869209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 111 - 210
Target Start/End: Complemental strand, 45583548 - 45583445
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttatt---catctttaaggtgaatttctctagcca |
206 |
Q |
| |
|
|||||||||||||| |||||||||||||| | |||||| ||||||||| ||| ||||||||||||||| ||||||||| || |||||||||| ||| |
|
|
| T |
45583548 |
ctcatttggtaagggataatgcataatatatataggggttagggttcgaatcccagacaccccacttattcatcatctttaaagtaaatttctctaacca |
45583449 |
T |
 |
| Q |
207 |
ctag |
210 |
Q |
| |
|
|||| |
|
|
| T |
45583448 |
ctag |
45583445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 188
Target Start/End: Complemental strand, 4478424 - 4478376
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
4478424 |
tgcaggggtcggggttcgaatcccggacatcccacttattcatctttaa |
4478376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 33780312 - 33780424
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa-ggtgaatttctctagccact |
208 |
Q |
| |
|
|||||||||||||| |||||||| ||||| | ||||||| |||||||||||| | || |||||||||||||||||| |||||||||| |||| ||| |
|
|
| T |
33780312 |
ctcatttggtaagggataatgcacaatatatacaggggttggggttcgaacctcaaactatccacttattcatctttaatagtgaatttctttagctact |
33780411 |
T |
 |
| Q |
209 |
aggctacttgacc |
221 |
Q |
| |
|
| ||||||||||| |
|
|
| T |
33780412 |
aagctacttgacc |
33780424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 52119377 - 52119445
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || |||||||||||||||||| |||| |
|
|
| T |
52119377 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggttcggggttcgaaccccggccacc |
52119445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 150 - 205
Target Start/End: Original strand, 7239851 - 7239906
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagcc |
205 |
Q |
| |
|
|||||||||||| || ||||||||||||||| ||||||||||| |||||||||||| |
|
|
| T |
7239851 |
ggggttcgaacctcgaacaccccacttattcgtctttaaggtggatttctctagcc |
7239906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 128 - 219
Target Start/End: Original strand, 20221461 - 20221552
Alignment:
| Q |
128 |
atgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||||| ||| || ||||||||| ||||||||| |||||| |||||||||||| ||||| ||||||| ||||| || |||||||||||| |
|
|
| T |
20221461 |
atgcatattatatgtaggggtcggtgttcgaacctcggacatcccacttattcacttttaaaatgaatttttctagtcattaggctacttga |
20221552 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 24136808 - 24136727
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatcttt---aaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| | ||| ||||||||||||||||||||||||||| |||| |||||||||| ||||||||||||||||||||||| |
|
|
| T |
24136808 |
tgcaggggccagggatcgaaccccggacaccccacttattca-ctttaaaaaggtgaatt--tctagccactaggctacttgacc |
24136727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 146 - 196
Target Start/End: Complemental strand, 36727513 - 36727462
Alignment:
| Q |
146 |
ggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
36727513 |
ggtcggggttcgaacctcggacaccccacttattcatcttataaggtgaatt |
36727462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 4139004 - 4139078
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
4139004 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
4139078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4227810 - 4227736
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||| | |||||||| | ||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
4227810 |
tgagtttagctcagttggtagggacattgcataatttatgcaggggtcggggttcgaactccggacaccccactt |
4227736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 13616127 - 13616073
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
13616127 |
aggggtcggagttcgaacctcggacaccccacttattcatcttataaggtgaatt |
13616073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 14417866 - 14417986
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| || |||| |||||| ||| ||||||| || || |||||||| || ||||||||||||||||||||||||||||| ||| |||||||||| |
|
|
| T |
14417866 |
ccatgagcatagctcaattggta-ggacaatgcattattatatgcaggggctggagttcgaaccccggacaccccacttattcaccttataaggtgaat- |
14417963 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| ||||| ||||| |
|
|
| T |
14417964 |
--tctagccactaagctacctgacc |
14417986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17602742 - 17602668
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||||| || ||||||||||||||||||||||||| |
|
|
| T |
17602742 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggccgaggttcgaaccccggacaccccactt |
17602668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19222652 - 19222578
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19222652 |
tgagcttaactcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
19222578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 24303394 - 24303468
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24303394 |
tgagcttagctcagttggcagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
24303468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 27066649 - 27066722
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||| ||| | |||||||| ||||| ||||||||||| |
|
|
| T |
27066649 |
tgcaggggtcagggttcgaaccccggacaccccacttattcaccttatgaggtgaat---tctagtcactaggctac |
27066722 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 28193802 - 28193876
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| ||||||||||||||| |||||||||||||| |||||| |
|
|
| T |
28193802 |
tgagcttaactcagttggtagggatattgcattttatatgcaggggtcggggtacgaaccccggacactccactt |
28193876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 28689734 - 28689664
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
28689734 |
cttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
28689664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 31327784 - 31327710
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
31327784 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
31327710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 31529024 - 31528950
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
31529024 |
tgagcttagctcagttggtagggatattgaatattatatgcaggagtcggggttcgaaccccggacactccactt |
31528950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 32776215 - 32776289
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32776215 |
tgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcactt |
32776289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 215
Target Start/End: Original strand, 35483308 - 35483381
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||| ||| |||||| ||| |||||||||||| |||| |
|
|
| T |
35483308 |
tgcaggggtcggggttcgaatcccggacaccccacttattcaccttataaggtaaat---tctagccactagactac |
35483381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 37800677 - 37800603
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
37800677 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
37800603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 40933897 - 40933823
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
40933897 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
40933823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 168
Target Start/End: Complemental strand, 40963777 - 40963711
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| ||| |||||||| ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
40963777 |
tgagcttaactcagttgataaggatattgcattttatatgcaggggtcggggttcgaaccccggaca |
40963711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 47098736 - 47098810
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
47098736 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccactt |
47098810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 48515451 - 48515377
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||||| | ||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
48515451 |
tgagcttaactcagttggtagggatattccataatttatgcaggggtcgaggttcgaaccccggacaccacactt |
48515377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 50234128 - 50234202
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
50234128 |
tgagcttacctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
50234202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 50496880 - 50496806
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
50496880 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
50496806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 52030160 - 52030239
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||| ||||||||| || || ||||||| | ||||||||||||||| ||||| |
|
|
| T |
52030160 |
tgcaggggccggggttcgaaccccggacaccctacttattcactttaaaagtgaatt--tttagccactaggctacctgacc |
52030239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 52974119 - 52974045
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
52974119 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
52974045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 52984014 - 52984088
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| | | |||| ||||||||||||||||||||||||| |||||| |
|
|
| T |
52984014 |
tgagcttagctcagttggtagggatattgcatattgtatgcaagggtcggggttcgaaccccggacactccactt |
52984088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 2732702 - 2732759
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
2732702 |
tgcaggggcaggggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
2732759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 142 - 199
Target Start/End: Original strand, 3784111 - 3784168
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||| | ||||| || || |||||||||| |
|
|
| T |
3784111 |
caggggtcggggttcgaaccccggacaccccaccttttcattttaaaagtgaatttct |
3784168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 17218489 - 17218566
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| |||||| ||| |||| ||| |||||||| |||||||||||| |||||| |
|
|
| T |
17218489 |
ccatgagcttagctcagttggtagggatattgcatattatatgcaagggccggggttcaaaccccggacactccactt |
17218566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 23820668 - 23820725
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||| ||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
23820668 |
tgcaggggccggagttcgaaccccagacaccccacttattcatcttataaggtgaatt |
23820725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 24160584 - 24160543
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
24160584 |
tgcaggggtcggggttcgaaccccggacactccacttattca |
24160543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 121 - 202
Target Start/End: Original strand, 24651145 - 24651225
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
||||||||||| || ||| |||| |||||| | |||||||||| || ||| |||||||||| |||||||||||||||||||| |
|
|
| T |
24651145 |
aaggataatgcgta-tatatgcaagggtcgagattcgaaccccagatacctcacttattcacctttaaggtgaatttctcta |
24651225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 34407146 - 34407101
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||||||||||| |
|
|
| T |
34407146 |
tgcaggggttggggttcgaaccccagacaccccacttattcatctt |
34407101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 171
Target Start/End: Original strand, 34847547 - 34847616
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
34847547 |
tgagcttaattcagttggtagggatattgcatattatatgcaggggtcggggttcgaactccggacaccc |
34847616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 48347328 - 48347271
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||| | |||||||||||||||||| || ||||||||||| |
|
|
| T |
48347328 |
tgcaggggtcggggttcgaacctcagacaccccacttattcattttataaggtgaatt |
48347271 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 49639070 - 49639146
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| ||| |||||||||| ||||||||||||| ||| ||||| |
|
|
| T |
49639070 |
aggggccggggttcgaaccccgaacaccccacttattcaccttgtaaggtgaat---tctagccactaggttacctgacc |
49639146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 159 - 220
Target Start/End: Complemental strand, 54964578 - 54964517
Alignment:
| Q |
159 |
accccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||| |||| |||||||||| ||||||| |||| |||||||||||||| |
|
|
| T |
54964578 |
accccggacaccccactatttcacctttaaggtgtatttctccagccgctaggctacttgac |
54964517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 143 - 199
Target Start/End: Original strand, 10959175 - 10959231
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
10959175 |
aggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
10959231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 196
Target Start/End: Original strand, 31698553 - 31698629
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| || || |||||| | ||||||||||||| || |||||||||||||||||||| ||||||||||| |
|
|
| T |
31698553 |
aggataatgcattattatatgcaggagccggggttcgaacctcgaacaccccacttattcatcttataaggtgaatt |
31698629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 150 - 219
Target Start/End: Original strand, 40160784 - 40160853
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatcttt---aaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||| ||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
40160784 |
ggggtttgaaccccggacaccccacttattcacctttaaaaaggtgaat---tctagccactaggctacttga |
40160853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 188
Target Start/End: Original strand, 45647309 - 45647393
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||||| |||| |||||| ||| | || |||| || |||||||| |||||||||||||||||||||| ||||| ||||| ||||| |
|
|
| T |
45647309 |
agcttagctcagttggtagggacattgtataaaatatgcagggggcggggttcgaaccccggacacctcacttcttcatatttaa |
45647393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 171
Target Start/End: Original strand, 48722269 - 48722317
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48722269 |
ggatattgcatattatatgcaggggtcggggttcgaaccccggacaccc |
48722317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 52945899 - 52945959
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| |
|
|
| T |
52945899 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccc |
52945959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 101 - 169
Target Start/End: Complemental strand, 54230160 - 54230092
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||| ||| |||| |||||||||| |||||||||||| |||| || | |||||||||||||||||||| |
|
|
| T |
54230160 |
atgagtttagctcagttggtaaggacaatgcataatatatgcaaggtttggggttcgaaccccggacac |
54230092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 169
Target Start/End: Complemental strand, 4200647 - 4200584
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||||||||||||||||||||| ||||| |
|
|
| T |
4200647 |
cttaactcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccagacac |
4200584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 165 - 220
Target Start/End: Original strand, 9738420 - 9738475
Alignment:
| Q |
165 |
gacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||| ||||| |||| |||||||| |
|
|
| T |
9738420 |
gacactccacttattcatctttaaggtgaatttctttagccgctagattacttgac |
9738475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 130 - 196
Target Start/End: Complemental strand, 14271993 - 14271926
Alignment:
| Q |
130 |
gcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||| |||||||| ||| |||||||||||||||||| || ||||||||||| ||||||||||| |
|
|
| T |
14271993 |
gcatattatatgcaggggccggagttcgaaccccggacacctcatttattcatcttataaggtgaatt |
14271926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 15975156 - 15975235
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||| ||||||| |||||| |||| |
|
|
| T |
15975156 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaacctcggacactccacttcttca |
15975235 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 176
Target Start/End: Complemental strand, 19996527 - 19996444
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || ||||| || |||| |||||| ||||| |||||| ||| |||||| || |||||||||||||||||||| |||||| |
|
|
| T |
19996527 |
caatccccgtgagcgtagctcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccggacactccactt |
19996444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 174
Target Start/End: Original strand, 28951717 - 28951792
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
||||||||||| |||| |||| ||||| | |||||||| | |||||||| |||||||||||||| |||||||||| |
|
|
| T |
28951717 |
ccatgagcttaactcaattggcaaggacattgcataatttatgcaggggctggggttcgaaccccagacaccccac |
28951792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 106 - 173
Target Start/End: Original strand, 29098700 - 29098767
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||| |||| |||||| |||| || ||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
29098700 |
cttaactcagttggtagagatattgtatattatatgcaggggtcggggttcgaaccccggacacccca |
29098767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 152 - 220
Target Start/End: Original strand, 30157053 - 30157119
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
30157053 |
ggttcgaaccccggacacccaacttattcaccttataaggtgaat---tctaaccactaggctacttgac |
30157119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 40548307 - 40548374
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
40548307 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacac |
40548374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 45871021 - 45871088
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| ||| |||| |||||| ||||| || ||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
45871021 |
tgagtttagctcagttggtagggatattgtatattatatgcaggggtcggggttcgaaccccggacac |
45871088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 50724406 - 50724484
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
50724406 |
tgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaagtgaat---tctagccactaggctacctgac |
50724484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 50788442 - 50788364
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||| || |||||| ||||||||||||||||| |||| |
|
|
| T |
50788442 |
tgcaggggttggggttcgaacctcggacaccccacttattcaccttaaaaagtgaat---tctagccactaggctacctgac |
50788364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 168
Target Start/End: Complemental strand, 3748668 - 3748602
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
3748668 |
tgagcttagctcagttggtagggatattgtatattatatgcaggggttggggttcgaaccccggaca |
3748602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 6920029 - 6919955
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
6920029 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccgaacactccactt |
6919955 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 9176652 - 9176578
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||| | | ||||||||||||||||||||| |||||| |
|
|
| T |
9176652 |
tgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacactccactt |
9176578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 201
Target Start/End: Original strand, 9489499 - 9489577
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||||||| || | |||||||| |||||||||||||| ||| |||| ||| |||| ||||||| ||||||||||| |
|
|
| T |
9489499 |
ggataatgcattatgtatgcaggggccggggttcgaaccctggataccctactatttcacctttaagatgaatttctct |
9489577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 10176969 - 10176895
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
10176969 |
tgaggttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
10176895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 11436512 - 11436582
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||||| || ||||||||||| ||||||||||||| |
|
|
| T |
11436512 |
cttaactcagttggtagggatattgcatattatatgcaggggccgtggttcgaaccctggacaccccactt |
11436582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 13540017 - 13539963
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
13540017 |
aggggttggggttcgaaccccggacaccccacttatttaccttataaggtgaatt |
13539963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 147 - 196
Target Start/End: Complemental strand, 16006555 - 16006505
Alignment:
| Q |
147 |
gtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
16006555 |
gtcggggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
16006505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17608385 - 17608311
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| |||||||| |||||||||||||| |||||| |||||| |
|
|
| T |
17608385 |
tgagcttaacttagttggtagggatattgcatattatatgcaggggccggggttcgaaccctggacactccactt |
17608311 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 18194342 - 18194416
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
18194342 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
18194416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 101 - 171
Target Start/End: Original strand, 20489818 - 20489888
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
||||||||| |||| |||||| || || |||||| ||| |||||||| ||| ||||||||||||||||||| |
|
|
| T |
20489818 |
atgagcttagctcagttggtagggttattgcatattatatgcaggggccggagttcgaaccccggacaccc |
20489888 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 22472380 - 22472306
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| |||| | | |||||||||||||||||||||||||||| |
|
|
| T |
22472380 |
tgagcttaactcagttggtagagatattgcatattatatgcaagagccggggttcgaaccccggacaccccactt |
22472306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 22501997 - 22501923
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
22501997 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
22501923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 24751316 - 24751278
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
24751316 |
tgcaggggccggggttcgaaccccggacaccccacttat |
24751278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 31327567 - 31327493
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||| || |||||| |
|
|
| T |
31327567 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggaaactccactt |
31327493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 181
Target Start/End: Complemental strand, 31902258 - 31902220
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
31902258 |
aggggtcggggttcgaactccggacaccccacttattca |
31902220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 36256735 - 36256662
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||||||||||| | |||||| ||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
36256735 |
tgcaggggtcggggttcgaacctcatacaccctacttattcaccttataaggtgaat---tctagccactaggctac |
36256662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 36476398 - 36476477
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||||||| || || ||||||| |||||||||||||||| ||||| |
|
|
| T |
36476398 |
tgcaggggccggagttcgaaccccgaacaccccacttattcactttaaaagtgaatt--cctagccactaggctacctgacc |
36476477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 37488526 - 37488452
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
37488526 |
tgagcttagctcagttggtagggatatcgcattttatatgcaggggccggggttcgaaccccggacactccactt |
37488452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 38562235 - 38562161
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| |||||||| |||||| ||| |||||| ||||| ||||||||||| ||||| |||||| |
|
|
| T |
38562235 |
tgagcttacctcaattgataaggatattgcatattatatgcaggagtcggagttcgaacccctgacactccactt |
38562161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 202
Target Start/End: Original strand, 40412306 - 40412368
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
||||| ||||||||||||||| ||||| |||||||||||| |||||| ||||||||||||| |
|
|
| T |
40412306 |
tgcagaggtcggggttcgaactttggacatcccacttattcacctttaaagtgaatttctcta |
40412368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 42271069 - 42270996
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| ||||||||| ||| |||||||||| |||||| |||||||||| |
|
|
| T |
42271069 |
tgcaggggccggggttcgaactccggacaccctacttattcaccttataaggtgaat---tctagctactaggctac |
42270996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42785898 - 42785972
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| | ||| | | ||||||||||||||||||||||| |||||||| |||| |
|
|
| T |
42785898 |
tgagcttaactcagttggtaaggatattatatattttatgcaggggtcggggttcgaaccctggacaccctactt |
42785972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 217
Target Start/End: Complemental strand, 42831981 - 42831876
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||| |||||| |||||||||||| ||| || || |||||| |||||||||||| ||| | |||||||| || ||||| |||||||| |||| || ||| |
|
|
| T |
42831981 |
ctcacttggtagggataatgcatattatatgtagaggtcggagttcgaaccccgaacatctcacttatttat-tttaatgtgaatttttctaaccgctaa |
42831883 |
T |
 |
| Q |
211 |
gctactt |
217 |
Q |
| |
|
||||||| |
|
|
| T |
42831882 |
gctactt |
42831876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 149 - 220
Target Start/End: Complemental strand, 42832109 - 42832040
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| ||| ||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
42832109 |
cggggttcgaaccccggacactccatttattcaccttataaggtgaat---tctagccactaggctacctgac |
42832040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 44652048 - 44651974
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | || ||||||||||||||| ||||||||| |
|
|
| T |
44652048 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggataccccactt |
44651974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 45701348 - 45701422
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||| || |||||| |
|
|
| T |
45701348 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggatactccactt |
45701422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 46845037 - 46844963
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||||||| ||||||||||||||||||| |||| |
|
|
| T |
46845037 |
tgagcttagctcaattggcagggacattgcataatttatgcaggggtcggagttcgaaccccggacaccctactt |
46844963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 48546177 - 48546251
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| || |||| ||||||||||||||||||||||| ||||| |
|
|
| T |
48546177 |
tgagcttagctcagttggtagtgatattgcatattatatgtagggatcggggttcgaaccccggacacctcactt |
48546251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 48739810 - 48739736
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
48739810 |
tgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccactt |
48739736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 111 - 173
Target Start/End: Complemental strand, 54408607 - 54408545
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
||||||||| | ||| | |||||||| | ||||| |||||||||||||||||||||||||||| |
|
|
| T |
54408607 |
ctcatttggcagggacattgcataatttatgcagaggtcggggttcgaaccccggacacccca |
54408545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 362982 - 363023
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
362982 |
tgcaggggtcggagttcgaaccccggataccccacttattca |
363023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 181
Target Start/End: Original strand, 3955351 - 3955388
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3955351 |
ggggccggggttcgaaccccggacaccccacttattca |
3955388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 4045690 - 4045645
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
4045690 |
tgcaggggtcgaggttcgaacttcggacaccccacttattcatctt |
4045645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 6488125 - 6488202
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||| ||||| |||||| |
|
|
| T |
6488125 |
ccatgagcttagctcaattggtagggatattgcatattatatgcaggggctagggttcgaaccccagacactccactt |
6488202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 14868724 - 14868765
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
14868724 |
tgcaggggccggggttcgaaccccgaacaccccacttattca |
14868765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 15085725 - 15085676
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| ||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
15085725 |
aatgcattttatatgcaggggtcggggttcgaaccccggacacctcactt |
15085676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 17729016 - 17729069
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
17729016 |
ggatattgcatattatatgcaggggtcggggttcgaaccctggacactccactt |
17729069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 19030245 - 19030298
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
19030245 |
ggatattgcatattatatgcaggggtcggggttcgaaccctggacactccactt |
19030298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 24130598 - 24130639
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
24130598 |
tgcaggggacggggtttgaaccccggacaccccacttattca |
24130639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 27329973 - 27329924
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
27329973 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
27329924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 28951905 - 28951946
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||||||||||| |
|
|
| T |
28951905 |
tgcaggggtcagggttcgaaccccgaacaccccacttattca |
28951946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 158 - 220
Target Start/End: Complemental strand, 34344816 - 34344756
Alignment:
| Q |
158 |
aaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
34344816 |
aaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgac |
34344756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 38682314 - 38682257
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||| |||||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
38682314 |
tgcaggggtcgggattcgaatcccggacaccctccttattcatcttataaggtgaatt |
38682257 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 38949687 - 38949752
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| | |||||||| | |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
38949687 |
ctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccgaacaccccactt |
38949752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 42665981 - 42665940
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
42665981 |
tgcaggggtcggagttcgaactccggacaccccacttattca |
42665940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #186
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 43280073 - 43280146
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||| | ||| | |||||||| | |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
43280073 |
gagcttagctcaattggcagggacattgcataatttatgcaggggccggggttcgaatcccggacaccccactt |
43280146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #187
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 44625266 - 44625217
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
44625266 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
44625217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #188
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 49443492 - 49443415
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||| |||| | ||| | |||||||| | |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
49443492 |
ccatgagtttagctcaattggcagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccactt |
49443415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #189
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 49447151 - 49447216
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
49447151 |
ctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
49447216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #190
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 171
Target Start/End: Original strand, 51772893 - 51772962
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| |||||||||||||||||||||| | ||||||| |
|
|
| T |
51772893 |
tgagcttaacttagttggtagggatattgcatattatatgcaggggtcggggttcgaacctcagacaccc |
51772962 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #191
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 51879124 - 51879173
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
51879124 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
51879173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #192
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 4237045 - 4236974
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||||||| ||| |||||| ||| | |||||||| | |||||||| |||||||||||||||||||||||||| |
|
|
| T |
4237045 |
tgagcttagttcagttggtagggacattgcataatttatgcagggg-cggggttcgaaccccggacaccccac |
4236974 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #193
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 89 - 169
Target Start/End: Original strand, 7920311 - 7920391
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| |||| || |||||||| |||| |||||| ||||| |||||| ||| |||| | | ||||||||||||||||||||| |
|
|
| T |
7920311 |
aaatgaatccccgtgagcttagctcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccggacac |
7920391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #194
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 99 - 163
Target Start/End: Complemental strand, 21914134 - 21914070
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||| |||| || |||||||||||||| |
|
|
| T |
21914134 |
ccatgagcttaactcagttggtaaggacaatgcataatatatgcaaggtatggggttcgaacccc |
21914070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #195
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 26942759 - 26942831
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||| | ||||||||||| | |||||||||||| |
|
|
| T |
26942759 |
agcttagctcagttggtagggatattgcatattatatgcaggggccagggttcgaaccgcagacaccccactt |
26942831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #196
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 176
Target Start/End: Complemental strand, 29559742 - 29559666
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||| |||| |||||| ||||| |||||| ||| || || |||||||||| |||| |||||||||||||| |
|
|
| T |
29559742 |
catgagcttaactcagttggtagggatattgcatattatatgtagaggtcggggtttgaacttcggacaccccactt |
29559666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #197
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 30200827 - 30200895
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||| |||||| |||||||||||| |||| || | | ||||||||||||||||||| |
|
|
| T |
30200827 |
tgagcttagctcagttgctaaggacaatgcataatatatgcaaggtttgaggttcgaaccccggacacc |
30200895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #198
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 181
Target Start/End: Original strand, 32080099 - 32080135
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
32080099 |
gggtcggggttcgaaccccgaacaccccacttattca |
32080135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #199
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 181
Target Start/End: Original strand, 32665301 - 32665361
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| || || |||| |||||||||||| ||| |||||||||||||||||||| |
|
|
| T |
32665301 |
aggataatgcattattatatgcaagggtcggggttcaaactccggacaccccacttattca |
32665361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #200
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 47191412 - 47191491
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| || |||||||||||| |||||||||||||||| ||| |||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
47191412 |
tgcaggggctggagttcgaaccccgaacaccccacttattcaccttataagatgaat---tctagccactaggctacctgacc |
47191491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #201
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 50144653 - 50144605
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||| ||||||||||| |
|
|
| T |
50144653 |
cggggttcgaaccccggacactccacttattcaccttataaggtgaatt |
50144605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #202
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 52992123 - 52992051
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||||| | |||| |||||||| ||||||||| |||||||||||| |
|
|
| T |
52992123 |
agcttaactcagttggtagggatattgcataatttatgcaagggtcgggattcgaaccctcgacaccccactt |
52992051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #203
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 122 - 181
Target Start/End: Original strand, 54295226 - 54295286
Alignment:
| Q |
122 |
aggataatgcat-aatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| ||||| || ||||| ||||||||||||| ||||||| ||||||||||| |
|
|
| T |
54295226 |
aggataatgcattaatatatgtaggggccggggttcgaacctcggacactccacttattca |
54295286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #204
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 5636865 - 5636798
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||| |||||| |
|
|
| T |
5636865 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacac |
5636798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #205
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 15491884 - 15491931
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||| ||||||||| |||||||||||||| |||||||||||| |
|
|
| T |
15491884 |
tgcatattatatgcaggggttggggttcgaaccccagacaccccactt |
15491931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #206
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 19999871 - 19999938
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |
|
|
| T |
19999871 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacac |
19999938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #207
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 23090256 - 23090331
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||||||| |||| |||||||||||||| ||| |||||||||||| |
|
|
| T |
23090256 |
tgagcttaactcagttggtagagataaatgcataatatatgcaatggtcggggttcgaatcccagacaccccactt |
23090331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #208
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 28550385 - 28550314
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| || |||||||| |||||||||||| |
|
|
| T |
28550385 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccgaagttcgaactccggacacccca |
28550314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #209
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 173
Target Start/End: Original strand, 32144588 - 32144659
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| || | |||||| || || |||||| ||| |||||| | ||||||||||||||||||||||||| |
|
|
| T |
32144588 |
tgagcttagcttagttggtaggggtattgcatattatatgcaggagccggggttcgaaccccggacacccca |
32144659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #210
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 101 - 176
Target Start/End: Complemental strand, 36625238 - 36625163
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| |||| |||||| ||||| |||||| ||| |||||| || ||||||||||| ||| |||| |||||| |
|
|
| T |
36625238 |
atgagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaactccgaacactccactt |
36625163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #211
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 181
Target Start/End: Original strand, 36842203 - 36842242
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||| ||| |||||||||||| |
|
|
| T |
36842203 |
caggggtcggggttcgaaccccgtacatcccacttattca |
36842242 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #212
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 41799045 - 41798966
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||| ||||||| ||||||||||||| | |||| || | ||||||||||| | |||||| || ||||||| |
|
|
| T |
41799045 |
tgagcttatctcaattggtaaagataatgcataatttatgcatggataggggttcgaacttcagacacctcatttattca |
41798966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #213
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 87 - 162
Target Start/End: Complemental strand, 46796010 - 46795935
Alignment:
| Q |
87 |
ataaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||| |||| || |||||||| |||| |||||| ||||| ||||| ||| |||||||| |||||||||||||| |
|
|
| T |
46796010 |
ataaattaatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggggccggggttcgaaccc |
46795935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 95 - 176
Target Start/End: Complemental strand, 1697921 - 1697839
Alignment:
| Q |
95 |
atcaccatgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||||||| |||| || ||| ||||| |||||| | || |||||||||| |||||| ||||| ||||||||||||| |
|
|
| T |
1697921 |
atcaccgtgagcttaactcagttagtagggatattgcatatttatatgcaggggtcagggttcaaaccctggacaccccactt |
1697839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 3614146 - 3614072
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||| | |||||||| | |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
3614146 |
tgagcttagctctgttggtagggacattgcataatttatgcaggggcaggggttcgaacccctgacaccccactt |
3614072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3894548 - 3894622
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| |||||| | |||||||||||| |||||||| |||||| |
|
|
| T |
3894548 |
tgagcttagttcagttggtatggatattgcatattatatgcaggagccggggttcgaactccggacactccactt |
3894622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 4860165 - 4860239
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| | |||||||||||| |||||||||||| |
|
|
| T |
4860165 |
tgagcttagctcagttggtacggatattgcattttatatgcaggggctgaggttcgaaccccagacaccccactt |
4860239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 181
Target Start/End: Complemental strand, 5641659 - 5641601
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||| ||| |||||||| ||||||||||||| |||||||| ||||| |||| |
|
|
| T |
5641659 |
ggatattgcatattatatgcaggggccggggttcgaacctcggacacctcacttcttca |
5641601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 7269959 - 7270033
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| |||||||| |||||| |
|
|
| T |
7269959 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaactccggacactccactt |
7270033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 7938362 - 7938288
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| | ||| ||| || ||||||||||||||||||||| ||||| |||||| |
|
|
| T |
7938362 |
tgagcttaactcagttggtagggatattacattttatatgtaggggtcggggttcgaaccccagacactccactt |
7938288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 8762146 - 8762072
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| | |||| ||| |||||| ||||||||||||||| ||||||||||||| |
|
|
| T |
8762146 |
tgagcttaacttagttggtagggatattacatattatatgcaggtgtcggggttcgaaccatggacaccccactt |
8762072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 11820008 - 11820082
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| || ||| |||||||||||||||||||| || |||||| |
|
|
| T |
11820008 |
tgagcttagctcagttggtagggatattgcatgttatatgtaggagtcggggttcgaaccccggaaactccactt |
11820082 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #223
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 160
Target Start/End: Complemental strand, 13644766 - 13644708
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||| |||||||| |||||| ||||| || ||| ||| ||||||||||||||||||||| |
|
|
| T |
13644766 |
tgagtttatctcaattggtagggatattgtatattatatgcaggggtcggggttcgaac |
13644708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 19591645 - 19591571
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| |||| ||| |||||| ||| || ||| | ||||||||||||||||||||| |||||| |
|
|
| T |
19591645 |
tgagcttagctcagttgataagtatattgcatattatatgtaggagccggggttcgaaccccggacactccactt |
19591571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 170
Target Start/End: Original strand, 29631185 - 29631255
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||||| |||| |||||| ||| |||||||||||| |||| || ||||| ||| |||||||| |||| |
|
|
| T |
29631185 |
catgagcttagctcagttggtatggacaatgcataatatatgcaaggttcgggattcaaaccccggccacc |
29631255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 33607001 - 33606932
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| ||||| ||| ||||||||||||| |||||||||||||||| |||||| |
|
|
| T |
33607001 |
cttagctcaattggtagggatattgcattttatatgcaggggtcggg-ttcgaaccccggacactccactt |
33606932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 33706793 - 33706719
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||| ||| |||| | | ||||||||||||||||||||| |||||| |
|
|
| T |
33706793 |
tgagcttagctcaattggtagggatattacatattatatgcaagagccggggttcgaaccccggacactccactt |
33706719 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #228
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 34898833 - 34898759
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| |||||||| | |||||||||||| |||||||||||| |
|
|
| T |
34898833 |
tgagcttagttcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacaccccactt |
34898759 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #229
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 147 - 196
Target Start/End: Original strand, 35477777 - 35477827
Alignment:
| Q |
147 |
gtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
35477777 |
gtcggagttcgaactccggacaccccacttattcaccttataaggtgaatt |
35477827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #230
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 45713522 - 45713576
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||| |||||||| |||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
45713522 |
aggggccggagttcgaactccggacaccccacttattcaccttataaggtgaatt |
45713576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #231
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 156
Target Start/End: Complemental strand, 48315084 - 48315030
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttc |
156 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |||| || |||||||| |
|
|
| T |
48315084 |
tgagcttagctcagttggtaaggataatgcataatatatgcaaggtccggggttc |
48315030 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #232
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 169
Target Start/End: Complemental strand, 49194761 - 49194691
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||| |||| |||| |||||| | ||| |||||| ||| || ||||||| ||||||||||||||||||| |
|
|
| T |
49194761 |
ccatgaacttaactcaattggtaggaatattgcatattatatgtaggggtcagggttcgaaccccggacac |
49194691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #233
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 49983770 - 49983700
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||| | || ||||| | ||||||||| |||||||||||||||||||||| |||| |
|
|
| T |
49983770 |
cttagctcagttggtagggacattgtataatttatgcaggggttggggttcgaaccccggacaccctactt |
49983700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #234
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 173 - 219
Target Start/End: Complemental strand, 50332981 - 50332935
Alignment:
| Q |
173 |
acttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||||||| ||||||| ||||||||||||||| |||| |||||||| |
|
|
| T |
50332981 |
acttattcacctttaagatgaatttctctagccgctagactacttga |
50332935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #235
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 50659594 - 50659668
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
50659594 |
tgagcttaactcagttggtagggatatcacattttatatgcaggggccggggttcgaaccccggacactccactt |
50659668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #236
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 50675808 - 50675734
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||||| |||||| ||||| |||||| ||| | ||||||| | ||||||||| | ||||||||||||| |
|
|
| T |
50675808 |
tgagtttatctcagttggtagggatattgcatattatatacaggggttgtggttcgaactctggacaccccactt |
50675734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #237
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 53347356 - 53347282
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
53347356 |
tgagcttagctcagttggtagggatattgcatattatatgcagggactggggttcgaaccccagacactccactt |
53347282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #238
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 53577959 - 53578033
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| |||| | | ||||||||||||||||||||| |||||| |
|
|
| T |
53577959 |
tgagcttagctcagttggtagggatgttgcatattatatgcaagagccggggttcgaaccccggacactccactt |
53578033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #239
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 54769896 - 54769822
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| |||||| | ||| ||||||||| |||||||||||||| |
|
|
| T |
54769896 |
tgagcttagcttagttggtagggatattgcatattatatgcaggtgccggagttcgaaccacggacaccccactt |
54769822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #240
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 181
Target Start/End: Original strand, 55318059 - 55318097
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
55318059 |
aggggttgggattcgaaccccggacaccccacttattca |
55318097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #241
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 142 - 175
Target Start/End: Original strand, 6284918 - 6284951
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| |
|
|
| T |
6284918 |
caggggtcggggttcgaaccccagacaccccact |
6284951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #242
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 7043248 - 7043187
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcg-gggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||| | |||||||| |||||| || | |||||||||| ||||||||||||||| |
|
|
| T |
7043248 |
ttggtaaggatatttcataatatatgcaggtgtggagggttcgaactccggacaccccactt |
7043187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #243
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 8175799 - 8175856
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||| ||| ||||||||| ||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
8175799 |
tgcagggatcgaggttcgaactccgaacaccccacttattcaccttataaggtgaatt |
8175856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #244
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 8959488 - 8959545
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||| |||||||| |||||| | |||||||| |||||||||||||| ||||||||||| |
|
|
| T |
8959488 |
tgcatgggtcgggattcgaatctcggacacctcacttattcatcttataaggtgaatt |
8959545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #245
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 9167327 - 9167286
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
9167327 |
tgcaggggtcggggttcgaacttcggacaccccagttattca |
9167286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #246
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 16278007 - 16277966
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
16278007 |
tgcaggggtcgggattcgaactccggacatcccacttattca |
16277966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #247
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 19879243 - 19879284
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||| |||| |
|
|
| T |
19879243 |
tgcaggggccggggttcgaaccccgaacaccccacttcttca |
19879284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #248
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 20407304 - 20407353
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| ||||| | |||||||||||||||| |||||||||||| |
|
|
| T |
20407304 |
aatgcatattatatgcagagatcggggttcgaaccccagacaccccactt |
20407353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #249
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 21249046 - 21249005
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||| | |||||||||||||||| |
|
|
| T |
21249046 |
tgcaggggccggggttcgaaccctgaacaccccacttattca |
21249005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #250
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 22432967 - 22432926
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||| |||||||||||| ||||||||||| |
|
|
| T |
22432967 |
tgcaggggccggggttcaaaccccggacactccacttattca |
22432926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #251
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 26583140 - 26583185
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||| |||||||| || ||||||||||| |
|
|
| T |
26583140 |
tgcaggggtcggggttcgaactacggacacctcaattattcatctt |
26583185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #252
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 28226243 - 28226202
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||||||||| |
|
|
| T |
28226243 |
tgcaggggttggggttcgaatcccgaacaccccacttattca |
28226202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #253
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 204
Target Start/End: Original strand, 31202929 - 31203009
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
||||||| ||| |||| || || ||||| ||||||||| || ||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
31202929 |
ggataatacattatatatgtagtggtcgatgttcgaaccacgaacatcccacttattca-ctttaaggtgaatttctttagc |
31203009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #254
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 31673315 - 31673258
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
||||||| ||||| |||||||||||| |||||| ||| |||||| | ||||||||||| |
|
|
| T |
31673315 |
tgagcttgtctcagttggtaaggatattgcatattatatgcaggagccggggttcgaa |
31673258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #255
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 105 - 174
Target Start/End: Original strand, 32401498 - 32401566
Alignment:
| Q |
105 |
gcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
||||| |||| |||||| ||| | || ||||| | ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
32401498 |
gcttacctcagttggtagggacattgtataatttatgcaggggtcggg-ttcgaaccccggacaccccac |
32401566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #256
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 105 - 170
Target Start/End: Complemental strand, 35191874 - 35191809
Alignment:
| Q |
105 |
gcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||| |||| |||||||||| |||||||||||| |||| || |||||||||||||| |||||| |
|
|
| T |
35191874 |
gcttagctcagttggtaaggacaatgcataatatatgcaaggtctggggttcgaaccccagacacc |
35191809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #257
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 37279666 - 37279723
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||| ||| ||||||||||| || ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
37279666 |
tgcagaggttggggttcgaactccagacaccccacttattcaccttataaggtgaatt |
37279723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #258
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 221
Target Start/End: Complemental strand, 40415633 - 40415537
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||| || ||||| || | ||| || | | |||||| |||||||||| ||||||||||||||||||| | |||| |||||||||| |
|
|
| T |
40415633 |
gataatgcataatatatgtagggggcgtg-ttcaaatctcagacacctcacttattcacttttaaggtgaatttctctaacagctagactacttgacc |
40415537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #259
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 40786319 - 40786397
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt--taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||||||||||||||| | ||| |||||||||||| |||| |||||||||| |||| ||||||||||||||||| |
|
|
| T |
40786319 |
tgcatgggtcggggttcgaacctcagacgccccacttattc-tctttataaggtgaat---tctaaccactaggctacttgac |
40786397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #260
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 42108239 - 42108174
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| ||||| || |||| |||||||||||||| |||||||| |
|
|
| T |
42108239 |
ctcagttggtagggatattgcatattatatgcagaggccgggtttcgaaccccggacgccccactt |
42108174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #261
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 153 - 215
Target Start/End: Original strand, 48173338 - 48173398
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||||||| |||||||||| ||| |||||||||| ||||||||||| ||||| |
|
|
| T |
48173338 |
gttcgaaccccggacacctcacttattcaccttataaggtgaat---tctagccactaagctac |
48173398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #262
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 53467988 - 53468028
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
53467988 |
tgcagggg-cggggttcgaacctcggacaccccacttattca |
53468028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #263
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Complemental strand, 53633677 - 53633620
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| || | || ||||||||||| |
|
|
| T |
53633677 |
tgagcttaactcagttggtaaggataatgcataatatatgtaaggtccggggttcgaa |
53633620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #264
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 196
Target Start/End: Complemental strand, 335073 - 335029
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||| |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
335073 |
gttcgaaccctggacaccccacttattcaccttataaggtgaatt |
335029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #265
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 1149129 - 1149061
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || |||||||||||| ||||||| |
|
|
| T |
1149129 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtctagggttcgaaccctggacacc |
1149061 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #266
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 4216455 - 4216392
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| ||| |||||| |||||||||||| |||| || ||||||||||||||| ||||||| |
|
|
| T |
4216455 |
cttagctcagttgataaggacaatgcataatatatgcaagg-tcggggttcgaaccctggacacc |
4216392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #267
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 181
Target Start/End: Original strand, 7020818 - 7020854
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
7020818 |
gggtcggggttcgaaccccggtcacccaacttattca |
7020854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #268
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 156
Target Start/End: Original strand, 10926472 - 10926524
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttc |
156 |
Q |
| |
|
|||||| |||| |||||||||| |||||||||||| |||| || ||||||||| |
|
|
| T |
10926472 |
agcttagctcagttggtaaggacaatgcataatatatgcaaggttcggggttc |
10926524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #269
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 11668316 - 11668284
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||| ||||||||||||||||||| |
|
|
| T |
11668316 |
cggggttcgaaccacggacaccccacttattca |
11668284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #270
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 183
Target Start/End: Original strand, 12712007 - 12712051
Alignment:
| Q |
140 |
tgcaggggtcggg-gttcgaaccccggacaccccacttattcatc |
183 |
Q |
| |
|
||||||||||||| ||||||||||| ||| ||||||||||||||| |
|
|
| T |
12712007 |
tgcaggggtcgggagttcgaacccctgactccccacttattcatc |
12712051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #271
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 16663296 - 16663236
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||| |||||||| |||||| |||||||||||||||| |||| || |||||||| ||||| |
|
|
| T |
16663296 |
tgagattatctcagttggtatggataatgcataatatatgcaaggtccggggttcaaaccc |
16663236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #272
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 17440021 - 17439942
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| ||| ||||| |||| |||||||||||||| ||| |||||||||||| || |||||||||||| ||||| |
|
|
| T |
17440021 |
tgcaggggccggtgtttgaacctcggataccccacttattcaccttataaggtgaattt---taaccactaggctacctgacc |
17439942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #273
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 221
Target Start/End: Complemental strand, 18399704 - 18399629
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||||||||||||||| | ||| ||||| ||| ||||||||| |||||||||||| |||||||||| |
|
|
| T |
18399704 |
ggggttggggttcgaaccccggacacgctactcattcaccttaaaaggtgaat---tctagccactagactacttgacc |
18399629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #274
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 23148038 - 23147970
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| ||| |||||||| ||| || |||||||||||||||| ||||| |
|
|
| T |
23148038 |
tgagcttagctcagttggtaaggacaatacataatatatgcgaggtccggggttcgaaccccgaacacc |
23147970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #275
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Original strand, 23156517 - 23156553
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
23156517 |
tttaaggtgaatttctctagccaccaggctatttgac |
23156553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #276
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 26880195 - 26880255
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||| | |||||||| | ||||||||||||||||||||| | |||||||||||| |
|
|
| T |
26880195 |
ttggtatggacattgcataatttatgcaggggtcggggttcgaacttcagacaccccactt |
26880255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #277
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 32732565 - 32732529
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| |
|
|
| T |
32732565 |
tgcaggggtcggggttcgaactccggacactccactt |
32732529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #278
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 38131019 - 38130951
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || |||||||| |||||||| |||| |
|
|
| T |
38131019 |
tgagcttaactcagttggtatggacaatgcataatatatgcaaggtccggggttcaaaccccggccacc |
38130951 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #279
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 41121910 - 41121946
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
41121910 |
tgcagaggtcggggttcaaaccccggacaccccactt |
41121946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #280
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 124 - 172
Target Start/End: Complemental strand, 41411671 - 41411623
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||| |||||||| | ||||||| ||||||||| ||||||||||||||| |
|
|
| T |
41411671 |
gatattgcataatttatgcagggttcggggttcaaaccccggacacccc |
41411623 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #281
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 175 - 219
Target Start/End: Original strand, 41768447 - 41768491
Alignment:
| Q |
175 |
ttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||||| ||||||||||||||||||||||| ||| |||| |||| |
|
|
| T |
41768447 |
ttattcacctttaaggtgaatttctctagccgctaagctagttga |
41768491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #282
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 46469278 - 46469345
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| | || |||||||||||||| ||||| |||| |
|
|
| T |
46469278 |
tgagcttagctcagttggtaaggacaatgcataatatattca-aggtcggggttcgaatcccggccacc |
46469345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #283
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 180
Target Start/End: Complemental strand, 51412046 - 51412006
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||| ||||||||||||| |||||| ||||||||||||| |
|
|
| T |
51412046 |
tgcaggagtcggggttcgaatcccggataccccacttattc |
51412006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #284
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 52434719 - 52434659
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| ||| | ||| || ||||||||||||||||||||| |||||| |
|
|
| T |
52434719 |
ttggtagggatattgcatattatatacagaggacggggttcgaaccccggacactccactt |
52434659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #285
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 53734029 - 53733993
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
53734029 |
tttaaggtgaatttctctaaccactaggctatttgac |
53733993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #286
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 134 - 166
Target Start/End: Original strand, 54240638 - 54240670
Alignment:
| Q |
134 |
aatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
|||||||||||||||||||||||||||| |||| |
|
|
| T |
54240638 |
aatatgtgcaggggtcggggttcgaacctcgga |
54240670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #287
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 54349892 - 54349832
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||||| |||| |||| |||||||| ||||| |
|
|
| T |
54349892 |
ttggtagggatattgcatattatatgcaggggtcggagttcaaacctcggacacctcactt |
54349832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 100; Significance: 2e-49; HSPs: 288)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 2e-49
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 24134722 - 24134599
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
24134722 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
24134623 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||| ||||||| |
|
|
| T |
24134622 |
ctctagccactaggctgcttgacc |
24134599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 43109336 - 43109213
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| || ||||||||||||||||||||||| |
|
|
| T |
43109336 |
ccatgagcttagctcatttggtaagggataatgcaaaatatgtgcaggggccggggttcgaaccccggacacctcatttattcatctttaaggtgaattt |
43109237 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
43109236 |
ctctagccactaggctacttgacc |
43109213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 96; E-Value: 4e-47
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 49619969 - 49620092
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
49619969 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggtcggggttcagaccccggacaccccacttattcatctttaaagtgaattt |
49620068 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
49620069 |
ctctagccactaggctacttgacc |
49620092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 112 - 221
Target Start/End: Complemental strand, 25031582 - 25031472
Alignment:
| Q |
112 |
tcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25031582 |
tcatttggtaagagataatgcataatatgtgcaggggccggggttcgaattccggacaccccacttattcatctttaaggtgaatttctctagccactag |
25031483 |
T |
 |
| Q |
211 |
gctacttgacc |
221 |
Q |
| |
|
||| ||||||| |
|
|
| T |
25031482 |
gctgcttgacc |
25031472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 34702411 - 34702289
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||| |||||||||||||||||| ||||||| |
|
|
| T |
34702411 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacacctcacttattcatctttaagatgaattt |
34702312 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|| |||||||||| ||||||||| |
|
|
| T |
34702311 |
ctttagccactagactacttgac |
34702289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 106 - 221
Target Start/End: Original strand, 19424050 - 19424166
Alignment:
| Q |
106 |
cttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
|||| |||||||| ||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19424050 |
cttagctcatttgataagggataatgcatattatatgcaggggtcggggttcgaaccccggacaccccacttattcacctttaaggtgaatttctctagc |
19424149 |
T |
 |
| Q |
205 |
cactaggctacttgacc |
221 |
Q |
| |
|
| ||||||||||||||| |
|
|
| T |
19424150 |
cgctaggctacttgacc |
19424166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 7438618 - 7438741
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| |||| |||||||||||||||||| |||||||||||||||||||||||| ||||||||||| |
|
|
| T |
7438618 |
ccatgagcttagctcatttggtaagggataatgcacaatttgtgtaggggtcggggttcgaactccggacaccccacttattcatcttaaaggtgaattt |
7438717 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|| |||||||||| |||||||||| |
|
|
| T |
7438718 |
ctttagccactagactacttgacc |
7438741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 10123150 - 10123029
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| | |||||||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
10123150 |
ccatgagcttaactcatttggtaagggataatt-acaatatgtgtaggggtcggggttcgaaccccaaacaccccacttattcatctttaaggtgaattt |
10123052 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
10123051 |
ctctagccactaggctacttgac |
10123029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 83; E-Value: 2e-39
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 14262819 - 14262697
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||| ||||| |||||||| ||||| |||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
14262819 |
ccatgagattaactcatttgataagggataatgcacaatatatgcaggggtcggggttcgaaccccggacaccctacttattcatctttaaggtgaattt |
14262720 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| |||| ||||| |
|
|
| T |
14262719 |
ctctagccactaagctatttgac |
14262697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 15417915 - 15417792
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||| ||||| |||||||||| | ||||||||||||||||||||||||||| ||||||| |
|
|
| T |
15417915 |
ccatgagcttagctcatttggtaaaggataatgcacaatatgtgtaggggctggggttcgaagctcggacaccccacttattcatctttaagatgaattt |
15417816 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| ||||||||||||||||| |
|
|
| T |
15417815 |
ctctagtcactaggctacttgacc |
15417792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 48497311 - 48497188
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| |||||||||||||| ||| ||||||| ||||||||| ||| ||||||||||||||||| ||||| |
|
|
| T |
48497311 |
ccatgagtttagctcatttggtaagggataatgcacaatatgtgcaggggccggagttcgaatcccggacactccatttattcatctttaaggtaaattt |
48497212 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
48497211 |
ctctagccactaggctacttgacc |
48497188 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 40061440 - 40061562
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||| |||| ||||||| ||||| ||||||||||| ||||||||||||||||||||||||||||||| |||| |
|
|
| T |
40061440 |
ccatgagcttaactcatttggtaagggatagtgcacaatatgtataggggctggggttcgaactccggacaccccacttattcatctttaaggtggattt |
40061539 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
40061540 |
ctctagccactaggctacttgac |
40061562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 50011504 - 50011626
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
50011504 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggctggggttcgaaccccagacatcccacttattcatctttaaggtgaattt |
50011603 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| ||| | ||||||||| |
|
|
| T |
50011604 |
ctctagctactggactacttgac |
50011626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 77; E-Value: 8e-36
Query Start/End: Original strand, 100 - 219
Target Start/End: Original strand, 8893858 - 8893978
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||| ||||||| |||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8893858 |
catgagcttagttcatttggtaagggataatgcacaatatgtacaggggtcggggttcgaaccccaaacaccccacttattcatctttaaggtgaatttc |
8893957 |
T |
 |
| Q |
199 |
tctagccactaggctacttga |
219 |
Q |
| |
|
|| | |||||||| ||||||| |
|
|
| T |
8893958 |
tccaaccactaggttacttga |
8893978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 3347798 - 3347679
Alignment:
| Q |
102 |
tgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| | |||||||||| |||||||| | ||||||| |||| |||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
3347798 |
tgagcttaacacatttggtaatggataatgtacaatatgttcaggagtcggggttcgaaccccgtacaccccacttattcatctttaaggtgaatttctc |
3347699 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
||| ||||||||| |||||| |
|
|
| T |
3347698 |
tagtcactaggctgcttgac |
3347679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 99 - 217
Target Start/End: Original strand, 50065007 - 50065126
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||| |||||| |||||||| ||||| |||||||| ||||||||||||| ||||||||||| | ||||||||||||||||||||||||||||||||||| |
|
|
| T |
50065007 |
ccataagcttagctcatttgataagggataatgcacaatatgtgcagggaccggggttcgaatctcggacaccccacttattcatctttaaggtgaattt |
50065106 |
T |
 |
| Q |
198 |
ctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||| ||||||| |
|
|
| T |
50065107 |
ctctagccactaagctactt |
50065126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 47651869 - 47651990
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||| || |||| ||||||||||||| |||||||||||||| |
|
|
| T |
47651869 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggctggggttcgaatcctagacatcccacttattcat-tttaaggtgaattt |
47651967 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| ||||||||||| |
|
|
| T |
47651968 |
ctctagccactgggctacttgac |
47651990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 27054687 - 27054815
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggaca------ccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||| |||||||| ||||||||||||||| | || || |||||||||||||||||||| |
|
|
| T |
27054687 |
ccatgagcttagctcatttggtaagggataatgcacaatatctgcaggggccggggttcgaacccccggcataggcacctcacttattcatctttaaggt |
27054786 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
27054787 |
gaatttctctagccactaggctacttgac |
27054815 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 101 - 220
Target Start/End: Original strand, 30735827 - 30735947
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| ||| |||||||||| ||| ||| |||||| ||||||| ||||||||||||| ||||||||||||| |
|
|
| T |
30735827 |
atgagcttaactcatttggtaagggataatgcacaatttgtgcaggggccggagtttgaaccctggacaccacacttattcatctcaaaggtgaatttct |
30735926 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
||| ||||||||||||||||| |
|
|
| T |
30735927 |
ctaaccactaggctacttgac |
30735947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 12148671 - 12148548
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||| |||| ||||||| | |||||||||||||||||| |||| |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12148671 |
ccatgagcttagctcattttataagcgataatgtacaatatgtgcaggggtcggagttcaaaccccagacaccccacttattcatctttaaggtgaattt |
12148572 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| | |||||| || ||||||| |
|
|
| T |
12148571 |
ctctggacactagactgcttgacc |
12148548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 100 - 220
Target Start/End: Complemental strand, 2017781 - 2017661
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||||||||| || |||||||||| |||||||||||||||| ||||| ||||||||||||||| |
|
|
| T |
2017781 |
catgagcttagctcatttggtaagggataatgcacaatatgtgcataggctggggttcgaatcccggacaccccacttgttcat-tttaaggtgaatttc |
2017683 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| ||||||||| |
|
|
| T |
2017682 |
tctagccactaaactacttgac |
2017661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 137 - 221
Target Start/End: Complemental strand, 16985994 - 16985910
Alignment:
| Q |
137 |
atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| | ||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
16985994 |
atgtgcaggggttgaggttcgaaccccggacacctaacttattcatctttaaggtgaatttctctagccactaggttacttgacc |
16985910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 103 - 202
Target Start/End: Complemental strand, 52164465 - 52164365
Alignment:
| Q |
103 |
gagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| ||||||||||||| ||||||||| ||||||||||||| |||||||||||| |||||||||||||||||| || |||||||||||||||||| |
|
|
| T |
52164465 |
gagcttaactcatttggtaagagataatgcacaatatgtgcagggatcggggttcgaattccggacaccccacttattaatttttaaggtgaatttctct |
52164366 |
T |
 |
| Q |
202 |
a |
202 |
Q |
| |
|
| |
|
|
| T |
52164365 |
a |
52164365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 4126896 - 4127019
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| ||||| ||||| || || ||| |||| |||||||||||| ||||||||||||||||||||||| |
|
|
| T |
4126896 |
ccatgagtttagctcatttggtaagggataatgcacaatatatgcagaggccgatgtttgaacaccggacaccccatttattcatctttaaggtgaattt |
4126995 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
4126996 |
atctagccactagactacttgacc |
4127019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 124 - 219
Target Start/End: Complemental strand, 29936753 - 29936658
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||| |||||||||||||||||||||||| || ||||||||||||||||| |||||||||||| |
|
|
| T |
29936753 |
gataatgcacgatttgtgcaggggtcggagttcgaactccggacaccccacttattcatcttaaaagtgaatttctctagccattaggctacttga |
29936658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 12973376 - 12973254
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||||||||| |||||||| ||||| |||||||| || | ||| ||| || ||||||||||||||||||||||||||| ||||| |
|
|
| T |
12973376 |
ccatgagtttagctcatttggtaagggataatgcacaatatatgcaggggccgagattcaaactcctgacaccccacttattcatctttaaggtaaattt |
12973277 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|| |||||||||| ||||||||| |
|
|
| T |
12973276 |
ctttagccactagactacttgac |
12973254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 42946540 - 42946442
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| ||| |||||||| |||||| ||||||||||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||| |
|
|
| T |
42946540 |
ggataatgcatattatatgcaggggctggggtttgaaccccggacaccccacttattcaccttaaaggtgaatttctctagccgttaggctacttgacc |
42946442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 29332323 - 29332404
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| ||| ||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
29332323 |
tgcatgggccggggtttgaaccccggacaccccacttattcacctttaaggtgaatttctctagccgctaggctacttgacc |
29332404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 111 - 217
Target Start/End: Complemental strand, 50302937 - 50302830
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtc-ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccact |
208 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||| || | ||||||||||||| | |||| | |||||||||||||||||||||||||||||||||||| |
|
|
| T |
50302937 |
ctcatttggtaagggataatgcataatatgtgcagagggctggggttcgaaccctg-acactctacttattcatctttaaggtgaatttctctagccact |
50302839 |
T |
 |
| Q |
209 |
aggctactt |
217 |
Q |
| |
|
|| |||||| |
|
|
| T |
50302838 |
agactactt |
50302830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 4684271 - 4684153
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||||||||| |||||| | ||||| || ||||||||||||||||| |||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
4684271 |
gagcttacctcatttggtaagggataatgtacaatatatgtaggggtcggggttcgaagttcggataccccatttattcatctttaaggtgaattactct |
4684172 |
T |
 |
| Q |
202 |
agccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||| |
|
|
| T |
4684171 |
agccactaaactacttgac |
4684153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 23368830 - 23368708
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| ||||| |||||||| | | ||||||||| || ||||||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
23368830 |
ccatgagcttagctcatttgataagggataatgcacattttgtgcagggaccgatgttcgaaccccggacaccccacttattcacattaaaggtgaattt |
23368731 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
23368730 |
atctagccactagtctacttgac |
23368708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 35195684 - 35195586
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| ||| ||||||| | |||||||||||||| |||| ||||||||||| ||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
35195684 |
ggataatgcatattatatgcagggaccagggttcgaaccccgtacactccacttattcacctttaaggtaaatttctctagccgctaggctacttgacc |
35195586 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 155 - 221
Target Start/End: Complemental strand, 49239888 - 49239822
Alignment:
| Q |
155 |
tcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
49239888 |
tcgaaccccggacaccccacttattcatctttaaggtaaatttctctagccactaagctacttgacc |
49239822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 52720706 - 52720802
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||||| |||| |||| |||||||||||||| |||||| ||||||||||||||||| ||||||||||||| ||||||| |||||||| |
|
|
| T |
52720706 |
ggataatgcataatgtgtgtagggactggggttcgaaccccagacaccacacttattcatctttaaagtgaatttctctaaccactagactacttga |
52720802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 47428993 - 47428870
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| ||||| |||||||| ||| | || |||||||||| ||| |||||||||||||| ||||||||||||||||||||||| |||||||| |
|
|
| T |
47428993 |
ccatgagtttagctcatctggtaagggatagtacacaatatgtgcatgggctggggttcgaaccccaaacaccccacttattcatctttaaagtgaattt |
47428894 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|| ||||||||| |||| |||||| |
|
|
| T |
47428893 |
ctttagccactaagctatttgacc |
47428870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 102 - 219
Target Start/End: Original strand, 22779223 - 22779341
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| |||||||||| | | | |||| ||||||||||||||||| |||||||||||||||| |||||| |||||||||| |
|
|
| T |
22779223 |
tgagcttagctcacttggtaagggataatgcatattttatacaggagtcggggttcgaaccccaaacaccccacttattcacctttaaaatgaatttctc |
22779322 |
T |
 |
| Q |
201 |
tagccactaggctacttga |
219 |
Q |
| |
|
|||||| ||| |||||||| |
|
|
| T |
22779323 |
tagccaatagactacttga |
22779341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 29491509 - 29491587
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |||||| ||||||| |||||||||||||||| |||||| |
|
|
| T |
29491509 |
tgcaggggtcggggttcgaaccccggacaccccacttattca-ctttaaagtgaatt--tctagccactaggctatttgacc |
29491587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 129 - 220
Target Start/End: Original strand, 32635168 - 32635258
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta-aggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||| ||||||||| |||||||||||||||||||||||||||||||| ||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
32635168 |
tgcattatatatgcaggggttggggttcgaaccccggacaccccacttattcaccttaagaggtgaatt--tctagccactaggctacttgac |
32635258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 2350421 - 2350351
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||| |||||||||||||||| |||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
2350421 |
ggggttcgaaccccgaacaccccacttattcacctttaaagtgaatttctttagccgctaggctacttgac |
2350351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 123 - 217
Target Start/End: Complemental strand, 10790566 - 10790472
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||| ||| ||| ||||||||| |||||| ||||||||||||||| ||||||| | ||||||||||||||||| ||||| |||||||||| |
|
|
| T |
10790566 |
ggataatgtatattatatgcaggggttggggtttgaaccccggacaccctacttatttacctttaaggtgaatttctgtagccgttaggctactt |
10790472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 25299881 - 25299979
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| |||| |||||||||| ||||||| |||| |||||||||||| |||| || |||||||||||||| |||| ||||||||||||||| |
|
|
| T |
25299881 |
ggataatgcattatatatgcaggggtcagggttcgtaccctggacaccccactatttcacctcgaaggtgaatttctccagccgctaggctacttgacc |
25299979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 25800406 - 25800308
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| ||| | || |||| |||||||| |||||||||||||||||||||||||||| ||||||||||||| || ||| || ||||||||||| |
|
|
| T |
25800406 |
ggataatgcacaatttatgtagggtccggggttccaaccccggacaccccacttattcatcttaaaggtgaatttctttaaccattaagctacttgacc |
25800308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 42490476 - 42490402
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42490476 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccccggacaccccactt |
42490402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 79 - 176
Target Start/End: Original strand, 21265637 - 21265734
Alignment:
| Q |
79 |
taattaagataaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| ||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
21265637 |
taattaatataatacaatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
21265734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 99 - 199
Target Start/End: Original strand, 35309722 - 35309822
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||| ||| | | ||||||||| || | |||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
35309722 |
ccatgagcttagctcatttggtaagggataatacatt-tgtatgcaggggttggaggtcgaaccccgaacaccccacttattcatctttaaggtgaattt |
35309820 |
T |
 |
| Q |
198 |
ct |
199 |
Q |
| |
|
|| |
|
|
| T |
35309821 |
ct |
35309822 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 114 - 210
Target Start/End: Complemental strand, 42937312 - 42937215
Alignment:
| Q |
114 |
atttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||| || |||||||| | |||||| | ||||||||||||||||||||||||||| |||||||| |
|
|
| T |
42937312 |
atttggtaaggaataatgcacaatatgtgcaggggttggagttcgaacttcagacaccttatttattcatctttaaggtgaatttctctcgccactag |
42937215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 15368844 - 15368923
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||||||| || |||||||||| ||||||||||||||||| ||||| |
|
|
| T |
15368844 |
tgcaggggccggggttcgaaccccggacaccccacttattcattttataaggtgaat---tctagccactaggctacctgacc |
15368923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 99 - 214
Target Start/End: Original strand, 44583585 - 44583700
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| ||||| ||||| ||| | | || |||||||||||||||||| |||||||| |||| |||||| ||||||||||||||| |
|
|
| T |
44583585 |
ccatgagcttaactcatttgataagggataatacatt-tgtatgtaggggtcggggttcgaactccggacactccacctattcacctttaaggtgaattt |
44583683 |
T |
 |
| Q |
198 |
ctctagccactaggcta |
214 |
Q |
| |
|
|||||||| ||||||| |
|
|
| T |
44583684 |
ctctagccgataggcta |
44583700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 111 - 221
Target Start/End: Original strand, 8310663 - 8310773
Alignment:
| Q |
111 |
ctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||| |||||||| ||||||| || |||| |||||||||| |||||||||||||||| ||||||| |||| |||||||||||||||||| | || ||| |
|
|
| T |
8310663 |
ctcacttggtaagagataatgtattatatatgcaggggtcagggttcgaaccccggataccccac-tattttactttaaggtgaatttctccaaccgcta |
8310761 |
T |
 |
| Q |
210 |
ggctacttgacc |
221 |
Q |
| |
|
|||||||||||| |
|
|
| T |
8310762 |
ggctacttgacc |
8310773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 11405495 - 11405573
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||| ||||| |||| |
|
|
| T |
11405495 |
tgcaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaagctacctgac |
11405573 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 123 - 219
Target Start/End: Original strand, 33931214 - 33931312
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt--taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||||| |||||| |||| | |||||||||||||||||| |||||||||||| || || |||||||||||||| ||||||| ||||||| |
|
|
| T |
33931214 |
ggataatgcataatttgtgcaagggttgtggttcgaaccccggacacaccacttattcatattaaaaatgtgaatttctctagtcactaggttacttga |
33931312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 94 - 176
Target Start/End: Complemental strand, 5190855 - 5190773
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||||||||||| |||| |||||| ||||| ||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
5190855 |
aatccccatgagcttagctcaattggtagggatatcgcatattatatgcaggggtcgaggttcgaaccccggacaccccactt |
5190773 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 17350100 - 17350179
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| |||||||||||||||| |||||| |
|
|
| T |
17350100 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctatttgacc |
17350179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 33207209 - 33207283
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33207209 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
33207283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 37662623 - 37662549
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||| ||||||||||||||||||||| |
|
|
| T |
37662623 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggtacgaaccccggacaccccactt |
37662549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 46532593 - 46532471
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| || || | ||| |||| |||| ||||||| | ||||||||||| |||| ||||||||||||||| |
|
|
| T |
46532593 |
ccatgagcttaactcatttggtaaggaataatgtattatgtatgctggggccgggattcgaacttcagacaccccactatttcacctttaaggtgaattt |
46532494 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| || ||| |||||||||| |
|
|
| T |
46532493 |
ctctaaccgctaagctacttgac |
46532471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 15774365 - 15774289
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||| ||||| ||||| |
|
|
| T |
15774365 |
aggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaagctacctgacc |
15774289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 22386330 - 22386224
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||||||||| || ||||| ||||||||||||||| |||||||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
22386330 |
gagcttagctcatttggtaagggattatgcacaatatgtgcaggggttggggttcgaaccccagacacc------------ctttaaggtgaatttctct |
22386243 |
T |
 |
| Q |
202 |
agccactaggctacttgac |
220 |
Q |
| |
|
||||||||| ||||||||| |
|
|
| T |
22386242 |
agccactagactacttgac |
22386224 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 111 - 219
Target Start/End: Complemental strand, 30325128 - 30325020
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||| |||||| | || |||||| | | |||||| | ||||||||||||||| ||||||||||||||||||| |
|
|
| T |
30325128 |
ctcatttgataagggataatgcataatatgtgtaggggttgaggctcgaactc-gaacaccctatttattcatctttaagatgaatttctctagccacta |
30325030 |
T |
 |
| Q |
210 |
ggctacttga |
219 |
Q |
| |
|
|||||||| |
|
|
| T |
30325029 |
aactacttga |
30325020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 40210013 - 40209892
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||| ||||||||| | |||||||| ||| || |||||||| ||||||||||| ||||| || || |||| ||||||||||||||| |
|
|
| T |
40210013 |
ccatgagcttagatcacttggtaagggacaatgcatattatatgtaggggtcgaagttcgaaccccaaacacctcattttttcacctttaaggtgaattt |
40209914 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
|||| |||||||| |||||||| |
|
|
| T |
40209913 |
ctctggccactagactacttga |
40209892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 99 - 209
Target Start/End: Original strand, 25421851 - 25421963
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||| ||| |||| ||||| ||||||| |||||| ||||| ||||||||||| ||| |||||||||| |
|
|
| T |
25421851 |
ccatgagcttaactcatttggtaagggacaatgcacaatttgtgtaggggctggggttcaaaccccagacactccacttattcaccttaaaaggtgaatt |
25421950 |
T |
 |
| Q |
197 |
tctctagccacta |
209 |
Q |
| |
|
|||||| |||||| |
|
|
| T |
25421951 |
tctctaaccacta |
25421963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 35473953 - 35474021
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |||| || || |||||||||||||||||||| |
|
|
| T |
35473953 |
tgagcttagctcaattggtaaggataatgcataatatatgcaaggttcagggttcgaaccccggacacc |
35474021 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 9527465 - 9527543
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||| |||||| |||||||||||||||||||||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
9527465 |
tgcaggggtcggggtttgaaccctggacaccccacttattcatcttataaggtgaat---tctagccactagactacctgac |
9527543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 22563390 - 22563464
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
22563390 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
22563464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 24253741 - 24253619
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||| ||| ||||| |||||||||||| | ||||||||||||| |||||||| | |||| | |||||||| ||||||| ||||||| |
|
|
| T |
24253741 |
ccatgagcttagctcacttgataagggataatgcataatttatgcaggggtcgggattcgaacctcagacatcttacttattcgcctttaagatgaattt |
24253642 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| || ||| ||||||||| |
|
|
| T |
24253641 |
ctctaaccgttagactacttgac |
24253619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 32594255 - 32594329
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
32594255 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
32594329 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 36666642 - 36666568
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
36666642 |
tgagcttagctcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
36666568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 40678862 - 40678941
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||| |||||||||||||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
40678862 |
tgcaggggccggggttcgatccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
40678941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 44732637 - 44732711
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
44732637 |
tgagcttaactcagttggtagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccactt |
44732711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 9768865 - 9768824
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9768865 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
9768824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 11238084 - 11238039
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
11238084 |
tgcaggggtcggggttcgaatcccggacaccccacttattcatctt |
11238039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 129 - 220
Target Start/End: Original strand, 32660858 - 32660948
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta-aggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||| |||||||| ||||||| ||||||||||||||||||| |||| ||| | ||||||||| |||||||||||||||||||||| |
|
|
| T |
32660858 |
tgcattatatatgcaggggctggggttcaaaccccggacaccccactttttcaccttaagaggtgaatt--tctagccactaggctacttgac |
32660948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 47683675 - 47683770
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||||||||||| || ||| |||||||||| ||| | || | |||||||| |||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
47683675 |
ggataatgcacaatatgtgcagaggccggagttcgaaccc-ggatatcc-agttattcatgtttaagatgaatttctctaaccactaggctacttgac |
47683770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 135 - 221
Target Start/End: Complemental strand, 50859428 - 50859344
Alignment:
| Q |
135 |
atatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| |||||||| |||||||| ||||||||||||||||| |||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
50859428 |
atatatgcaggggccggggttcaaaccccggacaccccacatattcaccttaaaaggtgaat---tctagccactaggctacttgacc |
50859344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 172 - 220
Target Start/End: Original strand, 15550940 - 15550988
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||| |||||||| |
|
|
| T |
15550940 |
cacttattcatctttaaggtgaatttctgtagccactaggttacttgac |
15550988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 19976608 - 19976535
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||| |||||| || || ||||||| ||||||||||||||||| |
|
|
| T |
19976608 |
tgcaggggccggggttcgaaccccggacaccccacatattcactttaaaagtgaatt--tctagccactaggctac |
19976535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 99 - 198
Target Start/End: Complemental strand, 35527433 - 35527334
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| |||||||||||| |||||||||| |||||||| ||||||||| ||| ||||||| |||| ||||||||| |||| ||||| |||||| |
|
|
| T |
35527433 |
ccatgaacttagctcatttggtaagggataatgcacaatatgtg-aggggtcggagtttgaaccccaaacactccacttatttatctataaggagaattt |
35527335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 6702580 - 6702659
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
6702580 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccacttcttca |
6702659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 217
Target Start/End: Original strand, 17916707 - 17916819
Alignment:
| Q |
102 |
tgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||| |||||||| || |||| ||||||||||||||||||||| |||||| ||| |||| |||||| ||||||||||| |
|
|
| T |
17916707 |
tgagcttagctcatttggtaaaggataatgtattatatatgcaggggtcggggttcgaac----tacaccctactatttcacctttaatgtgaatttctc |
17916802 |
T |
 |
| Q |
201 |
tagccactaggctactt |
217 |
Q |
| |
|
| || ||||||||||| |
|
|
| T |
17916803 |
caaccgctaggctactt |
17916819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 37490929 - 37491007
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| |||||| |||||| |||||||||| |||||||||||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
37490929 |
tgcaggggccggggtacgaaccacggacaccccgcttattcatcttataaggtgaat---tctagccactaggctacctgac |
37491007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 37733794 - 37733872
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| || ||||||||||||||||||||||||||||||||| ||| |||||||||| |||| |||||||||||| |||| |
|
|
| T |
37733794 |
tgcagtggacggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctaaccactaggctacctgac |
37733872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 145 - 220
Target Start/End: Complemental strand, 41618811 - 41618736
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||| |||| ||||| || ||||||| |||||||||||||||||||||| | || ||||||||| |
|
|
| T |
41618811 |
gggtcggggttcgaatcccgaacacctcagttattcacatttaaggtgaatttctctagccgccagactacttgac |
41618736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 1247259 - 1247333
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| |||||||| |||||||| | ||||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
1247259 |
tgagcttaactcagttgataaggatattgcataatttatgcaggggtcgaggttcgaaccccagacacctcactt |
1247333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 1570258 - 1570184
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
1570258 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
1570184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 6438130 - 6438056
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
6438130 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
6438056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 94 - 176
Target Start/End: Complemental strand, 6463110 - 6463028
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||||||||||| |||| |||||| ||||| || || ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
6463110 |
aatccccatgagcttagctcagttggtagggatattgtattttatatgcaggggccggggttcgaaccccggacactccactt |
6463028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 7166293 - 7166219
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||| |||||| |
|
|
| T |
7166293 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacactccactt |
7166219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 8865858 - 8865932
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||| ||||||||| |||||| |||||| |
|
|
| T |
8865858 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcgggattcgaaccctggacactccactt |
8865932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 9866250 - 9866176
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||||||||||||||| |||| |||| |||||| |
|
|
| T |
9866250 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccgaacactccactt |
9866176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 15819667 - 15819593
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
15819667 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
15819593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 16343032 - 16343106
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
16343032 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
16343106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 151 - 221
Target Start/End: Complemental strand, 31964661 - 31964591
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||| ||||| ||||||||||||||||| || ||||| ||||||| ||| ||||||||||| |
|
|
| T |
31964661 |
gggtttgaaccccgaacacctcacttattcatctttaaagtaaatttttctagccgctaagctacttgacc |
31964591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 33254732 - 33254806
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||| ||||||||||||| |||||| |
|
|
| T |
33254732 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccactt |
33254806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 33274904 - 33274978
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||| ||||||||||||| |||||| |
|
|
| T |
33274904 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttggaaccccggacactccactt |
33274978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 35605689 - 35605615
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
35605689 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaaccctaaacaccccactt |
35605615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 129 - 187
Target Start/End: Original strand, 42367743 - 42367801
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta |
187 |
Q |
| |
|
|||||| ||| |||||||| ||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
42367743 |
tgcatattatatgcaggggccggggttcgaatcccggacaacccacttattcatcttta |
42367801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 42735889 - 42735959
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||||||||||| ||| |||||||||||| |||||||||| ||||| ||| ||||||||||||||| |
|
|
| T |
42735889 |
cttaactcatttggtagggaaaatgcataatatatgcaggggtctgggtttgaattccggacaccccactt |
42735959 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 43021688 - 43021614
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||| |||||||| | | |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
43021688 |
tgagcttagcttagttggtagggacaatgcatattttatgcaggggtcggggttcgaacctcggacaccccactt |
43021614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 46965744 - 46965818
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
46965744 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
46965818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 50899576 - 50899502
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
50899576 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
50899502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 101 - 199
Target Start/End: Complemental strand, 52202358 - 52202260
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||| |||| |||| |||||| ||||||||||||||| | | |||||||||||||||| |||| | ||| |||||||||| ||| ||| ||||||||| |
|
|
| T |
52202358 |
atgaacttagctcagttggtagagataatgcataatatatactggggtcggggttcgaatcccgaatacctcacttattcaccttaaagatgaatttct |
52202260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 13870137 - 13870059
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||| ||| ||||||||||||||||||||| || || ||||||| ||||||||||||||||| |||| |
|
|
| T |
13870137 |
tgcaggggccggggtttgaatcccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgac |
13870059 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 31124707 - 31124630
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||| ||||| | |||||||| | |||||||| |||||||||||| ||||| ||||||||| |
|
|
| T |
31124707 |
ccatgagcttagctcagttggcaaggacattgcataatttatgcaggggccggggttcgaactccggataccccactt |
31124630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 32585387 - 32585465
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| ||||| | ||||||||| |||||||| ||||||||||||| |
|
|
| T |
32585387 |
tgcaggggcaggggttcgaaccccggacaccccactttttcatttaagaggtgaatt--tctagccattaggctacttgac |
32585465 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 41182813 - 41182854
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41182813 |
tgcaggggtcggggtttgaaccccggacaccccacttattca |
41182854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 49251451 - 49251410
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
49251451 |
tgcaggggtcggggttcgaaccccagacaccccacttattca |
49251410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 50199532 - 50199491
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
50199532 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
50199491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 104 - 221
Target Start/End: Complemental strand, 4069702 - 4069587
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta-aggtgaatttctcta |
202 |
Q |
| |
|
|||||| |||| |||||| |||| ||||| |||| |||||||| ||||||| |||||||||| | ||||||||||| ||| | |||||||| |||| |
|
|
| T |
4069702 |
agcttagctcagttggtacagatattgcattatatatgcaggggccggggtttgaaccccggattctccacttattcaccttaagaggtgaat---tcta |
4069606 |
T |
 |
| Q |
203 |
gccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
4069605 |
cccactaggctacttgacc |
4069587 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 13538498 - 13538438
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
13538498 |
ttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
13538438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 23930600 - 23930521
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||| | ||| ||| ||||| |||||||||||||||||| ||||| |
|
|
| T |
23930600 |
tgcaggggtcggggttcgaaccctggacaccccatttatttaccttataaagtgaa---ctctagccactaggctacctgacc |
23930521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 24910530 - 24910470
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||||| | |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
24910530 |
ttggtagggatattgcataatttatgcaggggtcagggttcgaaccccggacactccactt |
24910470 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 27745158 - 27745237
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| || ||||||||||| ||| ||||||| || || ||||||| |||||||||||||||||||||||||| ||||||| |
|
|
| T |
27745158 |
tgagcatagctcatttggta-ggaaaatgcattattatatgcagggatcggggttcgaaccccggacaccccatttattca |
27745237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 38021252 - 38021332
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| || |||| |||| ||||| ||||||| || || |||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
38021252 |
tgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattca |
38021332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 38448926 - 38448858
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || ||||||||||| |||||||||| |
|
|
| T |
38448926 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaatcccggacacc |
38448858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 99 - 146
Target Start/End: Complemental strand, 39304301 - 39304253
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggg |
146 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
39304301 |
ccatgagcttagctcatttggtaagggataatgcataatatgtgcaggg |
39304253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 46116230 - 46116151
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||| ||| |||||||||| |||| |||||||||||| ||||| |
|
|
| T |
46116230 |
tgcaggggctggggttcgaaccccggacaccccaattattcaccttataaggtgaat---tctaaccactaggctacctgacc |
46116151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 47719167 - 47719099
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |||| || |||| ||||||| ||||| |||| |
|
|
| T |
47719167 |
tgagcttaactcagttggtaaggataatgcataatatatgcaaggttcggagttcgaatcccggccacc |
47719099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 48110568 - 48110647
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| || ||||||||| |||||||| |||||||||||||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
48110568 |
tgcaggggttggagttcgaacctcggacacctcacttattcatcttataaggtgaa---atctagccactaggctacctgacc |
48110647 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 129 - 172
Target Start/End: Original strand, 10632725 - 10632768
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||| |
|
|
| T |
10632725 |
tgcataatttatgcaggggtcggggttcgaaccccggacacccc |
10632768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 19793565 - 19793643
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||||||| ||| |||||||||| |||| |||||||||||| |||| |
|
|
| T |
19793565 |
tgcaggggccggaattcgaaccccggacaccccacttattcaccttataaggtgaat---tctaaccactaggctacctgac |
19793643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 121 - 210
Target Start/End: Complemental strand, 20267959 - 20267877
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||||||||| ||| ||| |||||||||||| |||||||| |||||||||||| | |||||||||||||||||||| ||||||| |
|
|
| T |
20267959 |
aaggataatgtatattatatgcaggggtcggagttcgaac-------accccacttatttacctttaaggtgaatttctctaaccactag |
20267877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 26550498 - 26550565
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
26550498 |
tgagcttaactcagttggtagggatattgcatactatatgcaggagccggggttcgaaccccggacac |
26550565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 157 - 208
Target Start/End: Complemental strand, 27980172 - 27980121
Alignment:
| Q |
157 |
gaaccccggacaccccacttattcatctttaaggtgaatttctctagccact |
208 |
Q |
| |
|
||||||| |||||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
27980172 |
gaacccctaacaccccacttattcacctttaaggtaaatttctctagccact |
27980121 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 111 - 177
Target Start/End: Complemental strand, 34940502 - 34940436
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactta |
177 |
Q |
| |
|
|||| ||||||||| |||||||||| ||| |||||||||| || |||||||||||||||||||||||| |
|
|
| T |
34940502 |
ctcacttggtaagggataatgcatattatatgcaggggtcagg-ttcgaaccccggacaccccactta |
34940436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 176
Target Start/End: Complemental strand, 36314054 - 36313971
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||| ||| || |||| |||||| ||||| |||||| ||| |||||||| ||| |||||||||||| ||||||||||| |
|
|
| T |
36314054 |
caatccccattagcatagctcagttggtagggatattgcatattatttgcaggggccggagttcgaaccccgaacaccccactt |
36313971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 199
Target Start/End: Original strand, 39238755 - 39238814
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
39238755 |
tgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
39238814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 178
Target Start/End: Complemental strand, 2052738 - 2052700
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
2052738 |
tgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 2277758 - 2277832
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||| || |||||| |
|
|
| T |
2277758 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggagactccactt |
2277832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 2754364 - 2754438
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||||| |||||| ||| ||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
2754364 |
tgagcttagcttagttggtagggatattgcatattatatgccggggccggggttcgaaccccggacaccctactt |
2754438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 142 - 176
Target Start/End: Complemental strand, 3742343 - 3742309
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
3742343 |
caggggtcggggttcgaaccccggacaccccactt |
3742309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 6130099 - 6130025
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| |||||||||||||| |||||||| |||||| |
|
|
| T |
6130099 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaactccggacactccactt |
6130025 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 6893303 - 6893229
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
6893303 |
tgagcttagctcagttggtagggatattgcattttatatgcaggggccgaggttcgaaccccggacactccactt |
6893229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 7180680 - 7180606
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| | ||| |||||| ||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
7180680 |
tgaggttagctcagttggtaggaatattgcatattatatgcaggggccggagttcgaaccccggacaccccactt |
7180606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 10664860 - 10664787
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||| | |||||||||||||||||||||| |||||| |
|
|
| T |
10664860 |
tgagcttagctcagttggtagggatattgcatattatatgcagag-tcggggttcgaaccccggacactccactt |
10664787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 10851828 - 10851902
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| || ||| ||| |||||||| ||||||||||||||| || || |||||| |
|
|
| T |
10851828 |
tgagcttagctcaattggtaaggatattgtatattatatgcaggggacggggttcgaaccccagaaactccactt |
10851902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 11333672 - 11333742
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||| | |||||||| | |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11333672 |
cttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccactt |
11333742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 11491693 - 11491763
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||| | |||||||| | |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
11491693 |
cttagctcagttggtagggacattgcataatttatgcaggggccggagttcgaaccccggacaccccactt |
11491763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 18534005 - 18534079
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| || ||| ||||||||||||||||||||||| |||||| |
|
|
| T |
18534005 |
tgagcttagctcagttggtagagatattgcatattatatgtaggagtcggggttcgaaccccggacactccactt |
18534079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 24874975 - 24875049
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||||| | |||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
24874975 |
tgagcttagctcagttggtagggatattgcataatttatgcatgggcaggggttcgaacctcggacaccccactt |
24875049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 25999854 - 25999928
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
25999854 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactt |
25999928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 26584812 - 26584738
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
26584812 |
tgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
26584738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 30246090 - 30246016
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||| ||| | |||||||| ||||||||||||| ||||||||||| | ||||||||| |
|
|
| T |
30246090 |
tgagcttagctcatttggtagggacattgcataattgatgcaggggtcgggattcgaaccccgaataccccactt |
30246016 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 34058218 - 34058292
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | || |||||||||||||||||| |||||| |
|
|
| T |
34058218 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacactccactt |
34058292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 34562853 - 34562779
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||||| | | |||||| || ||||||||||||||||||||||||| |
|
|
| T |
34562853 |
tgagcttaactcagttggtagggatattacataatttatacaggggccgaggttcgaaccccggacaccccactt |
34562779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 217
Target Start/End: Original strand, 40288281 - 40288355
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
||||||||| ||||||||| |||||| | |||||||||| |||||| |||||||||||| || |||| |||||| |
|
|
| T |
40288281 |
aggggtcggagttcgaacctcggacatcacacttattcacttttaagatgaatttctctaaccgctagactactt |
40288355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 197
Target Start/End: Original strand, 41160865 - 41160939
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| || | |||||| ||||| ||||||| |||| |||| ||||| |||||||||||||||||||| |
|
|
| T |
41160865 |
ggataatgcattatgtatgcaggagtcggagttcgaatcccgaacactccactatttcatctttaaggtgaattt |
41160939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 144 - 215
Target Start/End: Original strand, 41677103 - 41677174
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattcatctt---taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||| ||| ||||||||| ||||||||||||||||| |
|
|
| T |
41677103 |
ggggtcggggttcgaactccggacaccccacttattcaccttgaaaaaggtgaat---tctagccactaggctac |
41677174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 45481494 - 45481560
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||||||||||||| |||||||||||| |||| || |||||||||||| ||||||| |
|
|
| T |
45481494 |
tgagcttaattcatttggtaaggacaatgcataatatatgcaaggtccggggttcgaactccggaca |
45481560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 47763441 - 47763362
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||| ||||||||| |||||| |||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
47763441 |
tgcaggggccggagttcgaacctcggacatcccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
47763362 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 48638536 - 48638610
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
48638536 |
tgagcttagctcagttggtagggatattgcattttatatgcaggggctggggttcgaaccccagacaccccactt |
48638610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 48897183 - 48897109
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||| | ||| |||||| ||| |||||||| | |||||||||| |||||||| |||||| |
|
|
| T |
48897183 |
tgagcttaactcatttggtaggaatattgcatattatatgcaggggccagggttcgaacaccggacactccactt |
48897109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 51942303 - 51942372
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| | ||||| ||||||||||||||||||||||||||||| |
|
|
| T |
51942303 |
cttaactcagttggtagggatattgcatattatatacaggg-tcggggttcgaaccccggacaccccactt |
51942372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 2903083 - 2903042
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| ||||||||||||||||||| |||||||||||||||| |
|
|
| T |
2903083 |
tgcagaggtcggggttcgaaccccgaacaccccacttattca |
2903042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 3341792 - 3341751
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
3341792 |
tgcaggggccggggatcgaaccccggacaccccacttattca |
3341751 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 104 - 181
Target Start/End: Complemental strand, 4865886 - 4865809
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| |||| |||||| ||| | |||||||||| || ||||||||| |||||||||||| |||| |||||| |||| |
|
|
| T |
4865886 |
agcttaactcagttggtagggacattgcataatatatgtaggggtcggagttcgaaccccgaacactccacttcttca |
4865809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 10052512 - 10052463
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||||||| |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
10052512 |
aatgtataatatatgcaggggccgaggttcgaaccccggacaccccactt |
10052463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 217
Target Start/End: Original strand, 10629365 - 10629481
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcagggg-tcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| |||| |||||||| ||||||||| ||| |||||||| | |||||||||||| |||||| |||| ||||||| |||| || ||||||| | |
|
|
| T |
10629365 |
tgagcttaactcacttggtaagatataatgcattttatatgcagggggttggggttcgaacctcggacatcccatttattcaccttt-agatgaattttt |
10629463 |
T |
 |
| Q |
200 |
ctagccactaggctactt |
217 |
Q |
| |
|
|||||||||| |||||| |
|
|
| T |
10629464 |
ttagccactagactactt |
10629481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 176
Target Start/End: Original strand, 11860087 - 11860120
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
11860087 |
aggggtcggggttcgaaccccggacaccccactt |
11860120 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 12502311 - 12502246
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
12502311 |
ctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaacccggacactccactt |
12502246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 18512616 - 18512567
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
18512616 |
aatgcattttatatgcaggggccggggttcgaaccccggacaccccactt |
18512567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 21884614 - 21884671
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| || |||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
21884614 |
tgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
21884671 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 23233976 - 23234029
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
23233976 |
ggatattgcatattatatgcaggggtcggggttcgaaccccagacaccctactt |
23234029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 23464042 - 23464001
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
23464042 |
tgcaggggccggggttcgaaccccggacaccccacttgttca |
23464001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 101 - 170
Target Start/End: Original strand, 24253775 - 24253844
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| ||||||||||| ||||| |||||| ||| |||||||||| |||||||||||| |||||| |
|
|
| T |
24253775 |
atgaacttagctcatttggtagggatattgcatattatatgcaggggtcaaggttcgaaccccagacacc |
24253844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 221
Target Start/End: Original strand, 25819233 - 25819303
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||| |||||||||||||| || || ||||||| |||||||||||| |||| ||||| |
|
|
| T |
25819233 |
cggggttcgaaccccggataccccacttattcactttaaaagtgaatt--tctagccactagactacctgacc |
25819303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 184
Target Start/End: Complemental strand, 29917629 - 29917568
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatct |
184 |
Q |
| |
|
||||||| || ||| ||||||||| | |||||||||||||| |||||| ||||||||||||| |
|
|
| T |
29917629 |
ggataatacacaatttgtgcagggattggggttcgaaccccagacacctcacttattcatct |
29917568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 181
Target Start/End: Complemental strand, 33843239 - 33843182
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| |||||||| | ||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
33843239 |
gatattgcataatttatgcagaggtcggggttcgaaccccgaacaccccacttcttca |
33843182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 148 - 181
Target Start/End: Original strand, 33844664 - 33844697
Alignment:
| Q |
148 |
tcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33844664 |
tcggggttcgaaccccggacaccccacttattca |
33844697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 148 - 181
Target Start/End: Complemental strand, 33949314 - 33949281
Alignment:
| Q |
148 |
tcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
33949314 |
tcggggttcgaaccccggacaccccacttattca |
33949281 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 124 - 181
Target Start/End: Original strand, 33950740 - 33950797
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| |||||||| | ||||| ||||||||||||||||||| ||||||||||| |||| |
|
|
| T |
33950740 |
gatattgcataatttatgcagaggtcggggttcgaaccccgaacaccccacttcttca |
33950797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 154 - 220
Target Start/End: Original strand, 35593816 - 35593880
Alignment:
| Q |
154 |
ttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||| |||||||||| ||||||| ||||||||| |||| |
|
|
| T |
35593816 |
ttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccgctaggctacctgac |
35593880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 42831986 - 42832043
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||| |||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
42831986 |
tgcaggggctggggttcaaaccccggacaccccacttattcaccttataaggtgaatt |
42832043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 42908810 - 42908855
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||| ||||| ||||||||||||| |||| |
|
|
| T |
42908810 |
tgcaggggtcggggttcgaactccggataccccacttattcttctt |
42908855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 179
Target Start/End: Original strand, 43092151 - 43092231
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||||||| || |||| |||||| ||||||| ||| || || |||||||||||||||||||||| ||||||||| ||||||| |
|
|
| T |
43092151 |
ccatgagcataactcaattggta-ggataatacattattatatgcaggggtcggggttcgaacctcggacacccaacttatt |
43092231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 43837457 - 43837416
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43837457 |
tgcaggggtcggggttcgaaccctggacaccccatttattca |
43837416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 144 - 181
Target Start/End: Complemental strand, 48260241 - 48260204
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
48260241 |
ggggtcggagttcgaaccccggacaccccacttattca |
48260204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 50118985 - 50119050
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| ||| |||| | | |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
50118985 |
ctcacttggtagggacaatccatattttatgcaggggtcggagttcgaaccccggacaccccactt |
50119050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 52961138 - 52961097
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||| ||||||||||||| |
|
|
| T |
52961138 |
tgcaggggccggggttcgaaccccggacgccccacttattca |
52961097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 151 - 220
Target Start/End: Complemental strand, 3533019 - 3532952
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||| ||| |||||||||| |||||| |||||||||| |||| |
|
|
| T |
3533019 |
gggttccaaccccggacaccccacttattcaccttataaggtgaat---tctagctactaggctacctgac |
3532952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #180
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 9639877 - 9639809
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || ||| ||||||||| |||||||| |
|
|
| T |
9639877 |
tgagcttaactcacttggtaaggacaatgcataatatatgcaaggtccggagttcgaacctcggacacc |
9639809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #181
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 221
Target Start/End: Original strand, 12553243 - 12553314
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatcttt----aaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||| ||||| |
|
|
| T |
12553243 |
ggggttcgaaccccggacaccccacttattca-ctttgaaaaaggtgaat---tctagccactaggctacctgacc |
12553314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #182
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 17283952 - 17284020
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || | |||||||||||| ||||||| |
|
|
| T |
17283952 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccagggttcgaaccctggacacc |
17284020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #183
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 17954915 - 17954842
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||| ||| |||||||| |||||||||||||||||||| || || ||||||| ||||||||||||||||| |
|
|
| T |
17954915 |
tgcagggatcgtggttcgaataccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctac |
17954842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #184
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 19063377 - 19063325
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| |||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
19063377 |
gatattgcatattatatgcaggggccggggttcgtaccccggacaccccactt |
19063325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #185
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 21638114 - 21638182
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| ||||||| |||| |||| || |||||||||||||||||||||| |
|
|
| T |
21638114 |
tgagcttagctcaattggtacggacaatgcatgatatatgcaaggtccggggttcgaaccccggacacc |
21638182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #186
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 138 - 221
Target Start/End: Complemental strand, 23681175 - 23681098
Alignment:
| Q |
138 |
tgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||| ||||| |||||| |||||||| |||||||| |||||||||||||| ||||||| ||||||||| |
|
|
| T |
23681175 |
tgtgcaggggtcggagttcggaccccgaacaccccatttattcat------ggtgaatttctctaaccactagattacttgacc |
23681098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #187
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 28564409 - 28564337
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| || ||| ||||| |||| | ||| ||||||||| |||||||||||| |||||||||||||| |
|
|
| T |
28564409 |
agcttaactcagttagtagggatattgcagattatatgcaggggttggggttcgaacctcggacaccccactt |
28564337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #188
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 149 - 196
Target Start/End: Complemental strand, 32711191 - 32711143
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
32711191 |
cggggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
32711143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #189
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 138
Target Start/End: Complemental strand, 37944190 - 37944154
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatat |
138 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
37944190 |
tgagcttatctcaattggtaaggataatgcataatat |
37944154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #190
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 213
Target Start/End: Original strand, 39433397 - 39433468
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggct |
213 |
Q |
| |
|
|||||||| || ||||||||| ||||||||||||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
39433397 |
tgcaggggccgatgttcgaacctcggacaccccacttattcaccttataaggtgaat---tctagccactaggct |
39433468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #191
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 181
Target Start/End: Complemental strand, 41833586 - 41833550
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41833586 |
gggtcggggttcgaaccccgaacaccccacttattca |
41833550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #192
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 47528507 - 47528439
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| ||| || || ||||||||||||||||||| |
|
|
| T |
47528507 |
tgagcttagctcagttggtaaggacaatgcataatatacgcaaggtccgaggttcgaaccccggacacc |
47528439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #193
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 52833162 - 52833089
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| |||||||||||||||||||| |||| ||||||| || || ||||||| ||||| ||||||||||| |
|
|
| T |
52833162 |
tgcaggggccggggttcgaaccccggacatcccatttattcactttaaaagtgaatt--tctagacactaggctac |
52833089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #194
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 1151763 - 1151842
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| | |||| | |||| |||||||||||||||| |||||| |||| |
|
|
| T |
1151763 |
tgagcttagctcagttggtagggatattgcatattatatacaggagccgggattcgaaccccggacactccacttcttca |
1151842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #195
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 176
Target Start/End: Original strand, 3311554 - 3311585
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
3311554 |
gggtcggggttcgaaccccggacaccccactt |
3311585 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #196
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 173
Target Start/End: Original strand, 8415733 - 8415803
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| |||| || ||| ||||| |||||| ||| ||||||||||||||||| |||||| ||||||||| |
|
|
| T |
8415733 |
tgagcttagctcagttcgtagggatattgcatattatatgcaggggtcggggttcaaacccc-gacacccca |
8415803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #197
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 105 - 176
Target Start/End: Original strand, 8780775 - 8780846
Alignment:
| Q |
105 |
gcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||| |||||| ||||| |||||| ||| |||||||| || ||||| |||| |||||||||||||| |
|
|
| T |
8780775 |
gcttaactcagttggtacggatattgcatattatatgcaggggccgaggttcaaacctcggacaccccactt |
8780846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #198
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 181
Target Start/End: Complemental strand, 9769626 - 9769595
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
9769626 |
ggggttcgaaccccggacaccccacttattca |
9769595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #199
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 99 - 141
Target Start/End: Original strand, 15550883 - 15550926
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtg |
141 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||| |||||||| |
|
|
| T |
15550883 |
ccatgagcttatctcatttggtaagggataatgcacaatatgtg |
15550926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #200
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 150 - 185
Target Start/End: Original strand, 16182858 - 16182893
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
16182858 |
ggggttcaaaccccggacaccccacttattcatctt |
16182893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #201
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 175
Target Start/End: Original strand, 18911893 - 18911928
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||| |
|
|
| T |
18911893 |
tgcaggggtcagggttcgaaccccggacaccccact |
18911928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #202
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 20030082 - 20030149
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
||||||||||||| |||||| | ||| ||||| ||| ||||||||||||||||||||| ||||||| |
|
|
| T |
20030082 |
tgagcttatctcagttggtaggaatattgcattttatatgcaggggtcggggttcgaacatcggacac |
20030149 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #203
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Complemental strand, 23991303 - 23991256
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
23991303 |
tgcataatttatgcaggggccggggttcgaaccctggacaccccactt |
23991256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #204
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 99 - 138
Target Start/End: Original strand, 31092659 - 31092698
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatat |
138 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
31092659 |
ccatgaacttaactcatttggtaaggataatgcataatat |
31092698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #205
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 94 - 173
Target Start/End: Original strand, 33033122 - 33033201
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
||||||| |||||||| ||| |||||| ||||| |||||| ||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
33033122 |
aatcaccgtgagcttaattcagttggtagggatattgcatattatatgcagggaccggggttcgaaccctagacacccca |
33033201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #206
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 33200042 - 33200117
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| || |||||||||| || |||||||||||||| || ||||||||| |||||| |
|
|
| T |
33200042 |
tgagcttagctcagttggtagggacaaatgcataatatatgtaggggtcggggttcaaatcccggacactccactt |
33200117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #207
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 35068718 - 35068765
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35068718 |
tgcatattatatggaggggccggggttcgaaccccggacaccccactt |
35068765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #208
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 162 - 201
Target Start/End: Original strand, 35308470 - 35308509
Alignment:
| Q |
162 |
ccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
35308470 |
ccggacacctcacttatttatctttaaggtgaatttctct |
35308509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #209
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 40519610 - 40519535
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcgggg-ttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||| |||||||||||||||| |||||| |
|
|
| T |
40519610 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccgggggttcgaaccccggacactccactt |
40519535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #210
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Complemental strand, 45416217 - 45416170
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
45416217 |
tgcataatttatgcaggggccggggttcgaatcccggacaccccactt |
45416170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #211
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 145 - 221
Target Start/End: Complemental strand, 47939250 - 47939176
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| ||||||||||| |||||||||||||||||||| ||| | |||||||| |||| |||||||||||| ||||| |
|
|
| T |
47939250 |
gggttggggttcgaactccggacaccccacttattcaccttattaggtgaat---tctaaccactaggctacctgacc |
47939176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #212
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 99 - 141
Target Start/End: Original strand, 48813731 - 48813774
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtg |
141 |
Q |
| |
|
|||||||||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
48813731 |
ccatgagcttatttcatttggtaagggataatgcataatatgtg |
48813774 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #213
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 1031629 - 1031683
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||| | |||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
1031629 |
aggggtcagagttcgaaccccgaacaccccacttattcaccttataaggtgaatt |
1031683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #214
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 3269623 - 3269689
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||| ||||| |
|
|
| T |
3269623 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccctggaca |
3269689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #215
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 4354161 - 4354088
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| ||| ||| |||||| ||||||||| ||||||| |
|
|
| T |
4354161 |
tgcaggggccggggttcgaacttcggacaccccacttattcaccttataaagtgaat---tctagccaccaggctac |
4354088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #216
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4482664 - 4482590
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||| |||||||||||||| || |||||| |
|
|
| T |
4482664 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccactt |
4482590 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #217
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 7191040 - 7191110
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| ||| || ||||| |||||| ||| |||||||| ||||||||||||||||||||| ||||| |
|
|
| T |
7191040 |
cttagctcagttgatagggatattgcatattatatgcaggggctggggttcgaaccccggacacctcactt |
7191110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #218
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 100 - 178
Target Start/End: Complemental strand, 7573763 - 7573685
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||||| |||| ||| | | ||| |||||||||| ||||||| || ||| ||||| |||||||||||||||||| |
|
|
| T |
7573763 |
catgagcttaactcaattgacaggaatattgcataatatatgcagggatcagggatcgaatcccggacaccccacttat |
7573685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #219
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 145 - 220
Target Start/End: Complemental strand, 8364459 - 8364386
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatc-tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| |||||||||||| || ||||||||||||| | |||||||||||| ||||| ||||||||||| |||| |
|
|
| T |
8364459 |
gggtcggagttcgaaccccgaacgccccacttattcaccttttaaggtgaat---tctagtcactaggctacctgac |
8364386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #220
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Complemental strand, 9872165 - 9872099
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
||||| || |||| ||||||||||||||||||||||| |||| || | | |||||||||||| |||| |
|
|
| T |
9872165 |
tgagcatagctcagttggtaaggataatgcataatatatgcaaggtttgcggttcgaaccccagaca |
9872099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #221
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 11215005 - 11215079
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| | |||||||||||| ||||| |||||| |
|
|
| T |
11215005 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctgaggttcgaaccccagacactccactt |
11215079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #222
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 12212296 - 12212358
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||| |||| | |||||||| ||||||| |
|
|
| T |
12212296 |
tgagcttaactcatttggtagggataatgcataatatatgcaacgtccggggttcaaaccccg |
12212358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #223
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 12613181 - 12613255
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| | |||||||||||||| | |||||| || | |||||||||||||||||||||| |
|
|
| T |
12613181 |
tgagtttagctcagttggtatgaataatgcataatatatacaggggccgagaatcgaaccccggacaccccactt |
12613255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #224
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Complemental strand, 12650446 - 12650376
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||||||||| ||||| ||| ||||| |||| | |||||||| ||||||||||||||| |
|
|
| T |
12650446 |
cttagctcagttggtaaggatattgcatgttatatgcagaggtcagagttcgaactccggacaccccactt |
12650376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #225
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 13773172 - 13773246
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||||||||| |||||| |
|
|
| T |
13773172 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccactt |
13773246 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #226
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 16997325 - 16997251
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| || |||||||| | | |||||||| || ||||||||||||||||||| ||||| |
|
|
| T |
16997325 |
tgagcttagctcagttggtagagacaatgcatattttatgcaggggccgaggttcgaaccccggacacctcactt |
16997251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #227
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 18467264 - 18467190
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
18467264 |
tgagcatagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
18467190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #228
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 18607875 - 18607801
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||| | |||||||| | |||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
18607875 |
tgagcttagctgagttggtagggacattgcataatttatgcaggggctggggttcgaaccccgaacaccccactt |
18607801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #229
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 19011359 - 19011433
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| || || |||||| |
|
|
| T |
19011359 |
tgagcttagctcaattggtagggatattgcatattatatgcaggggctggggttcgaaccccagatactccactt |
19011433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #230
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 27178774 - 27178700
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||||||||| || ||| ||| |||||||| ||| |||||| | |||||||||||||| |
|
|
| T |
27178774 |
tgagcttaactcaattggtaaggatattgtatattatatgcaggggccggaattcgaatctcggacaccccactt |
27178700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #231
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 170 - 216
Target Start/End: Complemental strand, 30351769 - 30351723
Alignment:
| Q |
170 |
cccacttattcatctttaaggtgaatttctctagccactaggctact |
216 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||||||| ||||||||| |
|
|
| T |
30351769 |
cccacttattcacatttgaggtgaatttctctagccattaggctact |
30351723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #232
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 132 - 182
Target Start/End: Original strand, 37203219 - 37203269
Alignment:
| Q |
132 |
ataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
||||||| |||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
37203219 |
ataatataagcagggtccggggttcgaaccccggacaccctacttattcat |
37203269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #233
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 153 - 220
Target Start/End: Original strand, 39434670 - 39434735
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| ||||||||||||||||||| ||| |||||||||| ||| ||||||||||| |||||| |
|
|
| T |
39434670 |
gttcgaacctcggacaccccacttattcaccttataaggtgaat---tcttgccactaggctgcttgac |
39434735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #234
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 214
Target Start/End: Complemental strand, 39994901 - 39994832
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
||||| ||||||| ||| |||||||| |||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
39994901 |
aggggccggggtttgaatcccggacatcccacttattcaccttataaggtgaat---tctagccactaggcta |
39994832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #235
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 168
Target Start/End: Original strand, 42054337 - 42054403
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||||| |||||||||||||| ||||| |
|
|
| T |
42054337 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggccggggttcgaaccctggaca |
42054403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #236
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 43884798 - 43884872
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||| |||||| |||||| |
|
|
| T |
43884798 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccactt |
43884872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #237
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 116 - 170
Target Start/End: Complemental strand, 45418109 - 45418055
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||||||||||||||||||||| |||| || || || ||||||| ||||||||| |
|
|
| T |
45418109 |
ttggtaaggataatgcataatatatgcaaggttcaggattcgaactccggacacc |
45418055 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #238
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 47469139 - 47469065
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||| | |||||||| | |||||||| | ||||||||||||||||||||||||| |
|
|
| T |
47469139 |
tgagcttagctcagttggcagggacattgcataatttatgcaggggctgaggttcgaaccccggacaccccactt |
47469065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #239
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 181
Target Start/End: Complemental strand, 47930728 - 47930658
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||||| |||||||||||| |||| ||||||||| |||| |
|
|
| T |
47930728 |
ctcagttggtagggatattgcatattatatgcaggggctggggttcgaacctcggataccccacttcttca |
47930658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #240
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 49916482 - 49916536
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||| |||||||| |||| |||||||| || ||||||||||| |
|
|
| T |
49916482 |
aggggtcggggttcgaatcccggacatcccatttattcatattataaggtgaatt |
49916536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #241
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 538385 - 538344
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
538385 |
tgcaggggccggagttcgaaccccgaacaccccacttattca |
538344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #242
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 1721179 - 1721220
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| ||||||||||||||||| |||||||||| |
|
|
| T |
1721179 |
tgcaggggccgggtttcgaaccccggacacctcacttattca |
1721220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #243
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 2643871 - 2643830
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| ||||||||||| ||||||| ||||||||||||||||| |
|
|
| T |
2643871 |
tgcatgggtcggggtttgaaccccagacaccccacttattca |
2643830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #244
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 4429538 - 4429481
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||| ||||||||||||| | ||| ||||||||||||||| ||||||||||| |
|
|
| T |
4429538 |
tgcaggggttggggttcgaaccctgaacattccacttattcatcttataaggtgaatt |
4429481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #245
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 219
Target Start/End: Original strand, 7006601 - 7006710
Alignment:
| Q |
111 |
ctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||| |||||||| ||||||||||| ||| ||||| || |||||| |||||||| | |||| | ||||||| ||||| |||||||| ||| ||| ||| |
|
|
| T |
7006601 |
ctcacttggtaagagataatgcatattatatgcagaggctggggtttgaaccccgaatacccaatttattcacatttaaagtgaatttatctggccgcta |
7006700 |
T |
 |
| Q |
210 |
ggctacttga |
219 |
Q |
| |
|
||||||||| |
|
|
| T |
7006701 |
tgctacttga |
7006710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #246
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 217
Target Start/End: Original strand, 9002204 - 9002297
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
||||||||||||||| | |||||| |||||| |||| || ||| | || ||||| ||||| ||||||||||||| |||| ||||| |||||| |
|
|
| T |
9002204 |
gataatgcataatatatataggggttggggtttgaacatcgaacatctcaattatttatcttaaaggtgaatttctttagctactagactactt |
9002297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #247
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 124 - 181
Target Start/End: Complemental strand, 12374557 - 12374501
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| |||||| ||| |||| ||||||||||||||| |||||||||||||||| |||| |
|
|
| T |
12374557 |
gatattgcatattatatgcaagggtcggggttcgaa-cccggacaccccacttcttca |
12374501 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #248
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 13941358 - 13941403
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||| ||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
13941358 |
tgcagggttcgaggttcgaacttcggacaccccacttattcatctt |
13941403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #249
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 17056936 - 17056895
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||| ||| ||||||||||||| |
|
|
| T |
17056936 |
tgcaggggccggggttcgaaccccagacgccccacttattca |
17056895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #250
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 17281051 - 17281147
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||| || |||||| | | |||||| | ||||||||| ||||||||| ||||| | |||| |||||| ||| |||| ||||||||| |
|
|
| T |
17281051 |
ggataatgcatattatatggaggggttgagattcgaatcacggacacccgacttattcacctttaggatgaa-ttctctggccgctagactacttgac |
17281147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #251
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 149 - 197
Target Start/End: Complemental strand, 17871128 - 17871079
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatc-tttaaggtgaattt |
197 |
Q |
| |
|
|||||||||||||||| |||||| ||||||||||| | |||||||||||| |
|
|
| T |
17871128 |
cggggttcgaaccccgaacaccctacttattcatcatgtaaggtgaattt |
17871079 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #252
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 18003855 - 18003896
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||| ||||| |||||||||||||||| |
|
|
| T |
18003855 |
tgcaggggccggggttcgagccccgaacaccccacttattca |
18003896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #253
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 18923941 - 18923884
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||| || ||||||||||| |||||||||||| |||||| ||| ||||||||||| |
|
|
| T |
18923941 |
tgcagggttcagggttcgaacctcggacaccccacgtattcaccttataaggtgaatt |
18923884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #254
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 141 - 215
Target Start/End: Original strand, 22346460 - 22346531
Alignment:
| Q |
141 |
gcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||| ||||||||| | |||||||| ||||||| ||| ||||||||| |||||||||||||||||| |
|
|
| T |
22346460 |
gcaggggtcggg-ttcgaaccctgaacaccccatttattcaccttataaggtgaa---ctctagccactaggctac |
22346531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #255
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 176
Target Start/End: Original strand, 30360457 - 30360490
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||||||| |||||| |
|
|
| T |
30360457 |
aggggtcggggttcgaaccccggacactccactt |
30360490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #256
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 30649132 - 30649173
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| || |||||||||||||| ||||||||||||||||| |
|
|
| T |
30649132 |
tgcaggagttggggttcgaaccccagacaccccacttattca |
30649173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #257
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 116 - 169
Target Start/End: Original strand, 33130765 - 33130818
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||| || || |||||| ||| ||||||||||||||||||||||||| |||| |
|
|
| T |
33130765 |
ttggtagggttattgcatattatatgcaggggtcggggttcgaaccccgaacac |
33130818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #258
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 152 - 196
Target Start/End: Complemental strand, 34560382 - 34560337
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||| ||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34560382 |
ggttcgaacctcggacaccccacttattcaccttataaggtgaatt |
34560337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #259
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Original strand, 36860623 - 36860676
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| ||||| || |||||| ||||||||||||||||||||| |
|
|
| T |
36860623 |
ggatattgcatattatatgcagaggccggggtccgaaccccggacaccccactt |
36860676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #260
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 43020650 - 43020691
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||| ||||| |
|
|
| T |
43020650 |
tgcaggggttggggttcgaacctcggacaccccactcattca |
43020691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #261
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 43237812 - 43237869
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||| | ||||||||| | ||||||||| ||||||||||| ||||||||||| |
|
|
| T |
43237812 |
tgcaggggtcagagttcgaaccacagacaccccagttattcatcttgtaaggtgaatt |
43237869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #262
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 50103890 - 50103939
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||| || ||||||| |||||||||||| ||||||| ||||| |
|
|
| T |
50103890 |
aatgcataatatatgtaggggtcagggttcgaaccctggacacctcactt |
50103939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #263
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 168
Target Start/End: Original strand, 2556562 - 2556626
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| |||| |
|
|
| T |
2556562 |
agcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagaca |
2556626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #264
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 3149524 - 3149488
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||| ||||| ||||| |
|
|
| T |
3149524 |
cggggttcgaaccccggacaccccaattatttatctt |
3149488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #265
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 3797856 - 3797935
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| || |||| |||||||||||| |||||||| || || ||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
3797856 |
tgagcataactcagttggtaaggata-tgcataattatatgtaggggctggggttcgaaccctagacaccccacttattca |
3797935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #266
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 125 - 197
Target Start/End: Original strand, 5315586 - 5315658
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||||||| ||| ||||| ||| |||||||||||||| | ||| || ||||| ||||||||||| ||||| |
|
|
| T |
5315586 |
ataatgcatattatatgcagaggttggggttcgaaccccaaatacctcatttatttatctttaaggtaaattt |
5315658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #267
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 5907800 - 5907868
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||| ||||| |||||||||||| |||| || | |||||| ||||||||||||| |
|
|
| T |
5907800 |
tgagcttagctcagttggcaaggacaatgcataatatatgcaaggtccagggttcaaaccccggacacc |
5907868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #268
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 122 - 185
Target Start/End: Complemental strand, 8261750 - 8261687
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| || || ||||||||||||||||| || ||| |||| |||||||||||||||| |
|
|
| T |
8261750 |
aggataatgcattattatatgcaggggtcggggttccaatcccagaca-cccacttattcatctt |
8261687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #269
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 9976431 - 9976399
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| |||||||||||||||||||| |
|
|
| T |
9976431 |
cggggttcgaactccggacaccccacttattca |
9976399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #270
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 10356243 - 10356175
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || |||||||||||| |||| |||| |
|
|
| T |
10356243 |
tgagcttaactcagttggtatggacaatgcataatatatgcacggtccggggttcgaactccggccacc |
10356175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #271
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 12048176 - 12048116
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| || ||| ||| |||||||| |||||||||| |||||||||||||||| |
|
|
| T |
12048176 |
ttggtagggatattgtatattatatgcaggggctggggttcgaatcccggacaccccactt |
12048116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #272
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 12404374 - 12404433
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| ||| ||||||| | ||||||||||||||| ||||||||||| |
|
|
| T |
12404374 |
ttggtagggatattgcatattatatgcagggct-ggggttcgaaccccgaacaccccactt |
12404433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #273
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 17487568 - 17487604
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||||| |
|
|
| T |
17487568 |
tgcaggggtcgggcttcaaaccccggacaccccactt |
17487604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #274
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 17889062 - 17889141
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| |||||||| || || || |||||| ||||||||||||| ||||||| |||||||||||| |
|
|
| T |
17889062 |
tgagcttaactcagttggta-ggataatgtattattatatgcaggaatcggggttcgaactccggacatcccacttattca |
17889141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #275
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 19262967 - 19262899
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||| |||||| ||||||||| || |||| | |||||||||||||||| |||||| |
|
|
| T |
19262967 |
tgagcttagctcagttgataaggacaatgcataacatatgcaaagttcggggttcgaaccccagacacc |
19262899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #276
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 152 - 220
Target Start/End: Original strand, 21361656 - 21361724
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| || |||||||| || ||||||||||||||||| | |||| ||||||||||||| |
|
|
| T |
21361656 |
ggttcgaaccccagataccccactatttaatctttaaggtgaatttattcagccgttaggctacttgac |
21361724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #277
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 185
Target Start/End: Original strand, 23750194 - 23750234
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
23750194 |
gggtcggggttcaaaccctgaacaccccacttattcatctt |
23750234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #278
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 181
Target Start/End: Complemental strand, 24168626 - 24168594
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||| ||||||||||||||||| |
|
|
| T |
24168626 |
cggggttcgaaccccagacaccccacttattca |
24168594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #279
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 128 - 176
Target Start/End: Complemental strand, 30604086 - 30604038
Alignment:
| Q |
128 |
atgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||||||||||||||||||| || ||| ||||||| |
|
|
| T |
30604086 |
atgcatgatatatgcaggggtcggggttcgaaccacgaacatcccactt |
30604038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #280
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 38020004 - 38019925
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaa-ccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||| ||||||| |||| ||||||||||||||||| ||| ||| |||||| ||||||||||||||||| |||| |
|
|
| T |
38020004 |
tgcaggggccggagttcgaaaccccagacaccccacttattcaccttataaagtgaat---tctagccactaggctacctgac |
38019925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #281
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 175
Target Start/End: Original strand, 40634214 - 40634278
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||| ||| ||||| |
|
|
| T |
40634214 |
ctcagttggtagggatattgcatattatatgcaggggatggggttcgaaccccgggcactccact |
40634278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #282
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 172
Target Start/End: Complemental strand, 40814822 - 40814790
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |
|
|
| T |
40814822 |
tgcaggggtcggggttcgaaacccggacacccc |
40814790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #283
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 43555930 - 43555851
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||| ||||||||| ||||| |||||||||||||||| | ||| ||||||| || |||||||||||| |||| ||||| |
|
|
| T |
43555930 |
tgcagggatcggggttcaaacccaggacaccccacttatttaccttataaggtggat---tctagccactagactacctgacc |
43555851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #284
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 166 - 202
Target Start/End: Original strand, 49895800 - 49895836
Alignment:
| Q |
166 |
acaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
49895800 |
acaccccacttattcacctttaagatgaatttctcta |
49895836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #285
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 50466379 - 50466315
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| ||||||||||||||| ||||||| | || ||||||| ||||||||| ||| |||| |
|
|
| T |
50466379 |
cttaactcaattggtaaggataatgtataatatatacaagggtcggagttcgaacctcggtcacc |
50466315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #286
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 50536982 - 50537042
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| |||||| || |||||| || |||||||||||| |||||||||||||| |
|
|
| T |
50536982 |
ttggtagggatattgcatataatatgcaggagttggggttcgaacctcggacaccccactt |
50537042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #287
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 175
Target Start/End: Complemental strand, 50824479 - 50824403
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||| |||| ||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| ||||| |
|
|
| T |
50824479 |
ccatgaacttagttcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccact |
50824403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #288
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 160
Target Start/End: Original strand, 51933508 - 51933568
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||| |
|
|
| T |
51933508 |
catgagcttagctcaattggtagggatattgcatattatatgcaggaatcggggttcgaac |
51933568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 99; Significance: 6e-49; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 99; E-Value: 6e-49
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 419709 - 419831
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| | |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
419709 |
ccatgagcttagctcatttggtaagggataatgaacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
419808 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
419809 |
ctctagccactaggctacttgac |
419831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 94; Significance: 6e-46; HSPs: 257)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 94; E-Value: 6e-46
Query Start/End: Original strand, 100 - 220
Target Start/End: Original strand, 4259857 - 4259978
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||| |||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
4259857 |
catgagcttaactcatttggtaagggataatgcacaatatgtgcaggggccggggttccaaccccggactccccacttattcatctttaaggtgaatttc |
4259956 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
4259957 |
tctagccactaggctacttgac |
4259978 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 87; E-Value: 9e-42
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 38289333 - 38289211
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||| |||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||| |
|
|
| T |
38289333 |
ccataagcttagctcatttggtaagggataatgcacaatatgtgcaggggtcggggttcgaacctcaaacaccccacttattcatctttaaggtgaattt |
38289234 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| |||||||||| |
|
|
| T |
38289233 |
ctctagccactaagctacttgac |
38289211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 99 - 207
Target Start/End: Complemental strand, 41454925 - 41454816
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
41454925 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccggacaccccacttattcatctttaatgtgaattt |
41454826 |
T |
 |
| Q |
198 |
ctctagccac |
207 |
Q |
| |
|
|||||||||| |
|
|
| T |
41454825 |
ctctagccac |
41454816 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 84; E-Value: 5e-40
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 1032567 - 1032690
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
1032567 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggctggggttcgaaccccagacaccccacttattcatctttaaggtgaattt |
1032666 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||| | || ||||||| |
|
|
| T |
1032667 |
ctctagccactggactgcttgacc |
1032690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 96 - 220
Target Start/End: Original strand, 22652677 - 22652802
Alignment:
| Q |
96 |
tcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaa |
194 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||||||||| |||||||||| ||| ||||||||||||||||||||| |||||||| || |||||||| |
|
|
| T |
22652677 |
tcaccatgagcttagctcatttgataagggataatgcataatttgtgcaggggccggtgttcgaaccccggacaccccaattattcatgttaaaggtgaa |
22652776 |
T |
 |
| Q |
195 |
tttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||| |||||||||| |
|
|
| T |
22652777 |
tttctctagccactaagctacttgac |
22652802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 39104607 - 39104725
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||| ||| |||||||||||||| |||||||| ||||||||||| || ||||||||||||||||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
39104607 |
tgagtttagctcatttggtaagggataatgcacaatatgtgcagcggccggggttcgaaccccggacaccc-acttattcatctttaaggtggatttctc |
39104705 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||||||||| |
|
|
| T |
39104706 |
tagccactagactacttgac |
39104725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 76; E-Value: 3e-35
Query Start/End: Original strand, 99 - 209
Target Start/End: Complemental strand, 41845527 - 41845416
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||||||||||||| ||||||||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
41845527 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcagggatcggggttcgaaccccgaacaccctatttattcatctttaaggtgaattt |
41845428 |
T |
 |
| Q |
198 |
ctctagccacta |
209 |
Q |
| |
|
|| ||||||||| |
|
|
| T |
41845427 |
ctttagccacta |
41845416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 19733167 - 19733045
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||| |||||| |||||||||||||| |||||||||||||| |||||||||||||||||||| |||| ||||| | ||||||||||||||||||||||| |
|
|
| T |
19733167 |
ccataagcttagctcatttggtaagggataatgcataatatatgcaggggtcggggttcgaatcccgaacacctaaattattcatctttaaggtgaattt |
19733068 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||| |||||||||| |
|
|
| T |
19733067 |
ctctaaccactaagctacttgac |
19733045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 36587748 - 36587626
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||| ||||| || |||||||| |||||||||||||| ||||||| |||||||||||||| ||||||||| ||||||| |
|
|
| T |
36587748 |
ccatgagcttaactcatttggtaagagataaaacacaatatgtgtaggggtcggggttccaaccccgaacaccccacttatttatctttaagatgaattt |
36587649 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||| ||||||||||||||||||| |
|
|
| T |
36587648 |
ctcgagccactaggctacttgac |
36587626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 74; E-Value: 5e-34
Query Start/End: Original strand, 100 - 220
Target Start/End: Complemental strand, 1360231 - 1360111
Alignment:
| Q |
100 |
catgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| ||||||||| || |||||||||| |||||||| ||||| ||||||||||||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
1360231 |
catgagcttagctcatttggcaaaggataatgcacaatatgtgtaggggctggggttcgaaccccggacaccccacttattcat-tttaaagtgaatttc |
1360133 |
T |
 |
| Q |
199 |
tctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||||||||||||||| |
|
|
| T |
1360132 |
tctaaccactaggctacttgac |
1360111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 111 - 220
Target Start/End: Complemental strand, 5904460 - 5904350
Alignment:
| Q |
111 |
ctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||||| |||||||||||||||||||| |||||||||||||||||||| |||||||||||||| |||| |
|
|
| T |
5904460 |
ctcatttggtaaaagataatgcacaatatgtgcaggggacggggttcgaaccccggacatcccacttattcatctttaagatgaatttctctagctacta |
5904361 |
T |
 |
| Q |
210 |
ggctacttgac |
220 |
Q |
| |
|
|||| ||||| |
|
|
| T |
5904360 |
agctatttgac |
5904350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 123 - 221
Target Start/End: Complemental strand, 43413959 - 43413861
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| ||| |||||||||| |||||||||| ||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43413959 |
ggataatgcacaatttgtgcaggggctggggttcgaatcccaaacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
43413861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 13906724 - 13906597
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| |||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
13906724 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcaggggccggggttcgaaccccgggcacggacacctcacttattcat-tttaaggt |
13906626 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||| |
|
|
| T |
13906625 |
gaatttctctagccactaggctatttgac |
13906597 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 106 - 217
Target Start/End: Complemental strand, 19957412 - 19957300
Alignment:
| Q |
106 |
cttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagc |
204 |
Q |
| |
|
|||| |||| ||||||||| |||||||||| ||| |||||||| || |||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
19957412 |
cttagctcacttggtaagggataatgcatattatatgcaggggacgaggttcgaaccccggacaccccacttattcacctttaaggtgaatttctctagc |
19957313 |
T |
 |
| Q |
205 |
cactaggctactt |
217 |
Q |
| |
|
||||||||||| |
|
|
| T |
19957312 |
agctaggctactt |
19957300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 103 - 219
Target Start/End: Complemental strand, 43456746 - 43456630
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||||||||| |||||||| ||||| || | |||||||||||||||||||||||||||||||||||||| |||||||||| ||||||| |
|
|
| T |
43456746 |
gagcttagctcatttggtaagggataatgcacaatatatgtaagggtcggggttcgaaccccggacaccccacttattcat-tttaaggtgattttctct |
43456648 |
T |
 |
| Q |
202 |
agccactaggctacttga |
219 |
Q |
| |
|
||||||| |||||||| |
|
|
| T |
43456647 |
gtccactagactacttga |
43456630 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 100 - 191
Target Start/End: Complemental strand, 36104019 - 36103927
Alignment:
| Q |
100 |
catgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
|||||||||| |||||||||||| |||||||||| |||||||||||||| ||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
36104019 |
catgagcttaactcatttggtaaaggataatgcacaatatgtgcaggggccggggttcgaaccccaaacaccccacttattcatctttaaggt |
36103927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 44828531 - 44828407
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatc-tttaaggtgaatt |
196 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||| ||| ||||||||| |||||||||||||| |||||| |||||||||||| ||||||||||||| |
|
|
| T |
44828531 |
ccatgagcttagctcatttggtaagggataatgcacaatttgtgcagggtctggggttcgaaccccagacaccacacttattcatcttttaaggtgaatt |
44828432 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgacc |
221 |
Q |
| |
|
||| |||||| ||| |||||||||| |
|
|
| T |
44828431 |
tctttagccattagactacttgacc |
44828407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 38063974 - 38064096
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| ||| ||||||||| |||| | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38063974 |
ccatgagcttaattcatttggtaagggataatgcacaatttgtgcagggactgggggttgaaccccagacaccccacttattcatctttaaggtgaattt |
38064073 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||| | ||||||||| |
|
|
| T |
38064074 |
ctctaaccactggactacttgac |
38064096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 45536715 - 45536837
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| ||||||| ||||| |||||||| ||| |||||||||| ||| ||||||||||||||||||||||||||||||||| | |||||||| |
|
|
| T |
45536715 |
ccatgaggttaggtcatttgataagggataatgcaaaatttgtgcaggggccggagttcgaaccccggacaccccacttattcatcttaatagtgaattt |
45536814 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| | ||||||| |
|
|
| T |
45536815 |
ctctagccactagacaacttgac |
45536837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 3311437 - 3311558
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||| |||| |||||| | ||| | ||||||| || ||||||||||||||||||||||||||||||||||| ||| ||||||| |
|
|
| T |
3311437 |
ccatgagcttaactcatttggcaagggataatgtacaatttatgcagggatcagggttcgaaccccggacaccccacttattcatcttaaagatgaattt |
3311536 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| || ||||||||| |
|
|
| T |
3311537 |
ttctagccagtatgctacttga |
3311558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Complemental strand, 8349576 - 8349459
Alignment:
| Q |
104 |
agcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||| ||||||||||||| |||||| || ||||| |||||||| ||| |||||||| ||| |||||||||||||||||||||||| ||||||| |||| |
|
|
| T |
8349576 |
agcttagctcatttggtaagtgataatacagaatatatgcaggggccggagttcgaactccgaacaccccacttattcatctttaagatgaatttatcta |
8349477 |
T |
 |
| Q |
203 |
gccactaggctacttgac |
220 |
Q |
| |
|
||||||| ||||||||| |
|
|
| T |
8349476 |
accactagactacttgac |
8349459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 10161961 - 10162088
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||| ||||| |||||||| |||||||| ||||||||||||||| ||||||||||||| ||| |||| ||||||||||| |||||||| |
|
|
| T |
10161961 |
ccatgagcttagctcatctggtaagggataatgcacaatatgtgcaggggttggggttcgaaccccgggcacgggcacctcacttattcat-tttaaggt |
10162059 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||| |||||||| |
|
|
| T |
10162060 |
gaatttctctagccactaggttacttgac |
10162088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 116 - 219
Target Start/End: Original strand, 10201276 - 10201380
Alignment:
| Q |
116 |
ttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||| ||||||||||||||| || |||||||||||||||||||||||||||| || ||||||| |||||| |||||||||||||||| || |||| |
|
|
| T |
10201276 |
ttggtaagagataatgcataatatatgtaggggtcggggttcgaaccccggacacctcatttattcacctttaaagtgaatttctctagccgttaagcta |
10201375 |
T |
 |
| Q |
215 |
cttga |
219 |
Q |
| |
|
||||| |
|
|
| T |
10201376 |
cttga |
10201380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 8350433 - 8350556
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatc-tttaaggtgaatt |
196 |
Q |
| |
|
|||| |||||| ||||||||||||| |||||| || ||||| |||||||| ||| ||||||||| ||||||||||||||||||||| |||||| |||||| |
|
|
| T |
8350433 |
ccataagcttaactcatttggtaagtgataatacacaatatatgcaggggccggagttcgaacctcggacaccccacttattcatcttttaagatgaatt |
8350532 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgac |
220 |
Q |
| |
|
| |||| ||||||| ||||||||| |
|
|
| T |
8350533 |
tatctaaccactagactacttgac |
8350556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 99 - 221
Target Start/End: Complemental strand, 34038046 - 34037923
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| || ||||| ||||| ||||| || |||||||||||||| ||| ||||||| ||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
34038046 |
ccatgagcttaacttatttgataagggataatacacaatatgtgcagggggcggagttcgaatcccagacatcccacttattcatctttaaagtgaattt |
34037947 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| ||||||| |||||||||| |
|
|
| T |
34037946 |
ttctaaccactagactacttgacc |
34037923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 123 - 220
Target Start/End: Original strand, 31153506 - 31153604
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccc-acttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| |||||||||||||| |||| |||||||| |||||||||| | |||||||||||||||||| ||||||||||| ||||| ||||||||| |
|
|
| T |
31153506 |
ggataatgcacaatatgtgcaggggccgggattcgaacctcggacacccccatttattcatctttaaggtggatttctctagctactagactacttgac |
31153604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 101 - 220
Target Start/End: Complemental strand, 11052680 - 11052560
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| | |||||||||| | ||| |||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
11052680 |
atgagcttaactcatttggtaagggataatgcacatattgtgcaggggccaaggtgtgaaccctaaacaccccacttattcatctttaaggtgaatttct |
11052581 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
11052580 |
ctagccactaggttacttgac |
11052560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 111 - 217
Target Start/End: Complemental strand, 280082 - 279976
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||| ||| |||||||||||||||||| | |||||||| |||||||||||||||||||| | ||| |
|
|
| T |
280082 |
ctcatttggtaagggataatgtacaatatgtgcaggggtaggg-ttcgaaccccggacacccaatttattcatttttaaggtgaatttctctagtcgcta |
279984 |
T |
 |
| Q |
210 |
ggctactt |
217 |
Q |
| |
|
| |||||| |
|
|
| T |
279983 |
gactactt |
279976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 111 - 217
Target Start/End: Original strand, 635770 - 635876
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||| ||| |||||||||||||||||| | |||||||| |||||||||||||||||||| | ||| |
|
|
| T |
635770 |
ctcatttggtaagggataatgtacaatatgtgcaggggtaggg-ttcgaaccccggacacccaatttattcatttttaaggtgaatttctctagtcgcta |
635868 |
T |
 |
| Q |
210 |
ggctactt |
217 |
Q |
| |
|
| |||||| |
|
|
| T |
635869 |
gactactt |
635876 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 111 - 217
Target Start/End: Original strand, 821573 - 821679
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||||||||||| |||||| | ||||||||||||||| ||| |||||||||||||||||| | |||||||| |||||||||||||||||||| | ||| |
|
|
| T |
821573 |
ctcatttggtaagggataatgtacaatatgtgcaggggtaggg-ttcgaaccccggacacccaatttattcatttttaaggtgaatttctctagtcgcta |
821671 |
T |
 |
| Q |
210 |
ggctactt |
217 |
Q |
| |
|
| |||||| |
|
|
| T |
821672 |
gactactt |
821679 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 17855647 - 17855769
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||| |||||| ||||||||||| | |||||||||| | | |||||||| ||||||||||||||||||||||||||||||||| ||||| |||||||| |
|
|
| T |
17855647 |
ccataagcttaactcatttggtaggcgataatgcatt-tgtatgcaggggccggggttcgaaccccggacaccccacttattcacatttaaagtgaattt |
17855745 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||| ||||| ||||||||| |
|
|
| T |
17855746 |
ttctagccgctaggttacttgacc |
17855769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 23139071 - 23139196
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatct--ttaaggtgaat |
195 |
Q |
| |
|
||||||||||| |||||||| |||| |||||||| ||| |||||||||| || ||||||||| || |||||||||||||||||| | ||||||||||| |
|
|
| T |
23139071 |
ccatgagcttagctcatttgacaagggataatgcacaatgtgtgcaggggccgaggttcgaacaccagacaccccacttattcattttattaaggtgaat |
23139170 |
T |
 |
| Q |
196 |
ttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||| ||||||||||| |
|
|
| T |
23139171 |
ttctctagtcactgagctacttgacc |
23139196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 99 - 188
Target Start/End: Original strand, 30466676 - 30466766
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| |||||||||||||| |||||||||||| | |||||||||||||||||||||||| |
|
|
| T |
30466676 |
ccatgagcttagctcatttggtaagggctaatgcacaatatgtgcaggggctggggttcgaacctcagacaccccacttattcatctttaa |
30466766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 102 - 207
Target Start/End: Complemental strand, 33820490 - 33820384
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| ||||||||||| || ||||| || ||| ||||||| |||||||||||||| ||| ||||||||| ||||||||||| |||||||||||||| |
|
|
| T |
33820490 |
tgagcttagctcatttggtatgggataatacacaatttgtgcagaggtcggggttcgaatcccagacaccccaattattcatcttaaaggtgaatttctc |
33820391 |
T |
 |
| Q |
201 |
tagccac |
207 |
Q |
| |
|
|| |||| |
|
|
| T |
33820390 |
taaccac |
33820384 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 103 - 220
Target Start/End: Complemental strand, 38545018 - 38544901
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| |||||||||||||| |||||||| |||||||||| || || ||||||||| |||| |||||| ||||||| |||||||||||| |||||||| |
|
|
| T |
38545018 |
gagcttacctcatttggtaagggataatgcacaatatgtgcatggatcagggttcgaatcccgaacaccc-acttatttatctttaaggtggatttctct |
38544920 |
T |
 |
| Q |
202 |
agccactaggctacttgac |
220 |
Q |
| |
|
| |||||| ||||||||| |
|
|
| T |
38544919 |
aaccactaaactacttgac |
38544901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 127 - 221
Target Start/End: Complemental strand, 43508517 - 43508425
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||| || ||||| ||||||| ||||||||||||||||||||||||| ||| |||||||||| ||||||||||||| | ||||||| |
|
|
| T |
43508517 |
aatgcataatatatgtaggggccggggtttgaaccccggacaccccacttattcaccttaaaggtgaatt--tctagccactaggttgcttgacc |
43508425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 125 - 218
Target Start/End: Complemental strand, 27102403 - 27102310
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttg |
218 |
Q |
| |
|
||||||||||||||||||| | | ||||||||| |||| ||||||||||| ||||| || |||||||||||||||||||||||| ||||||| |
|
|
| T |
27102403 |
ataatgcataatatgtgcatgtgatggggttcgatccccaaacaccccactttttcatgttaaaggtgaatttctctagccactagactacttg |
27102310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 100 - 219
Target Start/End: Complemental strand, 10621472 - 10621352
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||| ||| ||||| ||||||||| || | |||||||||| ||||| ||||||||||||||||| || |||| |||||| ||||||||| |
|
|
| T |
10621472 |
catgagcttagctcacttgataagggataatgcattatgtatgcaggggtcagggtttgaaccccggacaccccattttttcacctttaatgtgaatttc |
10621373 |
T |
 |
| Q |
199 |
tctagccactaggctacttga |
219 |
Q |
| |
|
| ||| ||||||||||||| |
|
|
| T |
10621372 |
ttccgccgctaggctacttga |
10621352 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 122 - 221
Target Start/End: Complemental strand, 4798616 - 4798518
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||| || || |||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| |||||||||||| |||| ||| |
|
|
| T |
4798616 |
aggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgtaaggtgaat---tctagccactagactacctga |
4798520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 31821129 - 31821006
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| ||| |||||| || ||||| ||||||| ||| ||| ||||||||||| |||| ||| |||||| |
|
|
| T |
31821129 |
ccatgagcttatctcatttggtaaaagataatgcacaatttgtgcatggatcgggattcgaactccgaacatcccacttattcttcttaaaagttgaatt |
31821030 |
T |
 |
| Q |
197 |
tctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||| |||| ||||| |
|
|
| T |
31821029 |
tctctaaccactatgctaattgac |
31821006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 2800058 - 2800137
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
2800058 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
2800137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 10083167 - 10083241
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10083167 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggtcgaggttcgaaccccggacaccccactt |
10083241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 27077163 - 27077089
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||||||||||||||| |||||||||||||||| |
|
|
| T |
27077163 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcggggttcgaatcccggacaccccactt |
27077089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 102 - 221
Target Start/End: Complemental strand, 8402402 - 8402284
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta-aggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||||| ||||| || ||||||||| |||||| | ||||||||||||| ||| | ||||||||| || |
|
|
| T |
8402402 |
tgagcttagctcaattggtagggacattgcataatatatgcagcggccggggttcgtaccccgaattccccacttattcaccttaagaggtgaatt--tc |
8402305 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
8402304 |
tagccactaggctacttgacc |
8402284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 91 - 176
Target Start/End: Original strand, 34894362 - 34894447
Alignment:
| Q |
91 |
atcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| || | |||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
34894362 |
atcaatccccgtaagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
34894447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 99 - 221
Target Start/End: Original strand, 39164979 - 39165099
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatcttta-aggtgaattt |
197 |
Q |
| |
|
||||||||||| |||| |||||| || | ||||||| || |||| ||| |||| ||||||| |||||||||||||||||||| ||| | ||||||||| |
|
|
| T |
39164979 |
ccatgagcttagctcagttggtagagacattgcataacatatgcaagggccggg-ttcgaacaccggacaccccacttattcaccttaagaggtgaatt- |
39165076 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
39165077 |
-tctagccactaggctacttgacc |
39165099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 123 - 210
Target Start/End: Complemental strand, 3728301 - 3728214
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||||||||||||||| ||| | ||||| ||||| || | |||||||| |||||||||| |||||||||||||||||| || |||||| |
|
|
| T |
3728301 |
ggataatgcataatatatgcggaggtcgaggttcaaatctcggacacctcacttattcacctttaaggtgaatttctcaagacactag |
3728214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 15042421 - 15042343
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| |||| |||||| |||||||||| |
|
|
| T |
15042421 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctaaccactacgctacttgac |
15042343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 23178957 - 23178878
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
23178957 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacactccacttcttca |
23178878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 153 - 220
Target Start/End: Complemental strand, 39172256 - 39172189
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |||||| |||||||||| ||||| |||||||||||||| |
|
|
| T |
39172256 |
gttcgaatcccggacaccccatttattcacctttaaagtgaatttctttagcccctaggctacttgac |
39172189 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 8265272 - 8265346
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||||| ||||||||||||||||||| |||||| |
|
|
| T |
8265272 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggtcagggttcgaaccccggacactccactt |
8265346 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 26192782 - 26192708
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| ||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
26192782 |
tgagcttagttcagttggtagggatattgcatattatatgcagaggtcggggttcgaaccccggacaccccactt |
26192708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 123 - 221
Target Start/End: Original strand, 30659975 - 30660073
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| || || | ||||||||||||||||| |||||||||||||||||| |||| ||||||||| ||||| || | || |||||||| |||||| |
|
|
| T |
30659975 |
ggataatgtattatgtatgcaggggtcggggttcaaaccccggacaccccactatttcacctttaaggtaaatttttccaaccgctaggctatttgacc |
30660073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 143 - 214
Target Start/End: Complemental strand, 43468758 - 43468689
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
43468758 |
aggggtcggggttcgaactccggacaccccacttattcaccttataaggtgaat---tctagccactaggcta |
43468689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 163 - 220
Target Start/End: Original strand, 8145835 - 8145892
Alignment:
| Q |
163 |
cggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||| || ||| |||||||||| |
|
|
| T |
8145835 |
cggacaccccacttattcacctttaaggtgaatttctctaaccgctacgctacttgac |
8145892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 12770369 - 12770446
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| ||| || ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
12770369 |
ccatgagcttagctcagttgatagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
12770446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 13537367 - 13537310
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
13537367 |
tgcaggtgtcggggttcgaaccccagacaccccacttattcatcttataaggtgaatt |
13537310 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 13626915 - 13626858
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||| ||||||||||||||||| ||||||||||||||||||||| ||||||||||| |
|
|
| T |
13626915 |
tgcaggtgtcggggttcgaaccccagacaccccacttattcatcttataaggtgaatt |
13626858 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 22274680 - 22274603
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||||||||||| |
|
|
| T |
22274680 |
ccatgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccccactt |
22274603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 144 - 220
Target Start/End: Original strand, 31129345 - 31129419
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| || || ||||||| | ||||||||||||||| |||| |
|
|
| T |
31129345 |
ggggtcggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tttagccactaggctacctgac |
31129419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 5328631 - 5328559
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
5328631 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacacctcactt |
5328559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 111 - 182
Target Start/End: Original strand, 16973031 - 16973103
Alignment:
| Q |
111 |
ctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||||||| ||||| |||||||| |||||||||||||||||| |||||||| ||||||| || |||||||||| |
|
|
| T |
16973031 |
ctcatttgttaagggataatgcacaatatgtgcaggggtcggtgttcgaactccggacatcctacttattcat |
16973103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 26022241 - 26022325
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
26022241 |
tcaatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacactccactt |
26022325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 199
Target Start/End: Original strand, 2696572 - 2696631
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || |||||||||| |
|
|
| T |
2696572 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatttct |
2696631 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 101 - 176
Target Start/End: Complemental strand, 2908158 - 2908083
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| || | || ||| ||| |||||||||||| |||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
2908158 |
atgagcttagcttagttagtagggacaatgcataatatatgcaggggccggggttcgaaccctggacaccccactt |
2908083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 8698646 - 8698567
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || |||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
8698646 |
tgagcttagctcagttggtagggatattgcatattatatgtaggggttggggttcgaatcccggacaccccacttcttca |
8698567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 93 - 176
Target Start/End: Complemental strand, 10736949 - 10736866
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
10736949 |
caatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
10736866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 162 - 217
Target Start/End: Complemental strand, 11690988 - 11690933
Alignment:
| Q |
162 |
ccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||| ||||||| ||||||||||||||||| |||| |||||||||||| |
|
|
| T |
11690988 |
ccggacaccccatttattcacctttaaggtgaatttctttagctactaggctactt |
11690933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 33570485 - 33570407
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||| ||| |||||||||| ||||||||||| ||||||||| |
|
|
| T |
33570485 |
tgcatgggtcggggttcgaacctcggacaccccacttattcaccttataaggtgaat---tctagccactaaactacttgac |
33570407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 89 - 176
Target Start/End: Original strand, 37717354 - 37717441
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
37717354 |
aaatgaatccccgtgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
37717441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 194
Target Start/End: Complemental strand, 44923353 - 44923298
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaa |
194 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||| ||||||||||| ||||||||| |
|
|
| T |
44923353 |
tgcaggggtcggggttcgaaccccggactccccatttattcatcttataaggtgaa |
44923298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 481015 - 481089
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
481015 |
tgagcttagctcagttggtagggacattgcataatttatgcaggggccgcggttcgaaccccggacaccccactt |
481089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 1588806 - 1588885
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| || || ||||||| ||||||||||| ||||| ||||| |
|
|
| T |
1588806 |
tgcaggggccggggttcgaacctcggacaccccacttattcactttaaaagtgaatt--tctagccactatgctacctgacc |
1588885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 2787147 - 2787073
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
2787147 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
2787073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 2792783 - 2792857
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
2792783 |
tgagcttagctcagttgatagggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
2792857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 5570898 - 5570972
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||||| ||||| ||||| ||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
5570898 |
tgagcttagctcagttggttgggatattgcatgttatatgcaggggtcggagttcgaaccccggacaccccactt |
5570972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 8034478 - 8034404
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||| || |||||||||||| |
|
|
| T |
8034478 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggccggggttcgaacaccagacaccccactt |
8034404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 116 - 178
Target Start/End: Original strand, 9370186 - 9370248
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||| ||||| |||||| ||| |||||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
9370186 |
ttggtagggatattgcatattatatgcaggggtcagggttcgaaccccggacacctcacttat |
9370248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 12831567 - 12831689
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| |||||||||||| ||| |||||| ||||||||||||| || ||||||| ||| |||| |||||||| | | ||| || |||||||| |
|
|
| T |
12831567 |
ccatgagtttaactcatttggtaaaggacaatgcacaatatgtgcagggtctggagttcgaatcccagacatcccacttaattaccttaaaagtgaattt |
12831666 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||| | ||||||| |
|
|
| T |
12831667 |
ctctagtcactagtcaacttgac |
12831689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 13059243 - 13059169
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||| | |||||||| |||||||||||||| |||||||||||| |
|
|
| T |
13059243 |
tgagcttagctcagttggtagggacaatgcataatttatgcaggggcaggggttcgaacccctgacaccccactt |
13059169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 16449129 - 16449203
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
16449129 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccagacactccactt |
16449203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 29114099 - 29114220
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| |||||||| ||||| |||||||| ||| |||||||||| || |||||| ||| || |||||||||||||| ||| | |||||||||| |
|
|
| T |
29114099 |
ccatgaacttagctcatttgataagggataatgcacaatttgtgcaggggccgcggttcgtacctcgaacaccccacttatt-atcgtaaaggtgaattc |
29114197 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||| | ||||||||| |
|
|
| T |
29114198 |
ttctaaccactcgactacttgac |
29114220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 29716864 - 29716938
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
29716864 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
29716938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 34413066 - 34413140
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
34413066 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
34413140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 38219634 - 38219560
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
38219634 |
tgagcatagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
38219560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 39484426 - 39484349
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||||||| |||||||||| |||| |||||| ||||||||| |
|
|
| T |
39484426 |
tgcaggggccggggttcgaatgccggacaccccacttattcatcttataaggtgaat---tctaaccactacgctacttga |
39484349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 40362052 - 40362126
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| || ||| ||||| |||||| ||| |||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
40362052 |
tgagcttagctcagttagtagggatattgcatattatatgcaggggtcggggttcgaacctcggacactccactt |
40362126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 43856448 - 43856374
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
43856448 |
tgagcttaactcagttggtagggatattgcattttatatgcaggggccggggttcgaaccccggacactccactt |
43856374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 10309716 - 10309659
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca-tctttaaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||| ||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
10309716 |
tgcaggggtcggggttcaaaccccgaacaccccacttattcactctataaggtgaatt |
10309659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 11231421 - 11231498
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| ||| | ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
11231421 |
ccatgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
11231498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Complemental strand, 14684269 - 14684193
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||||||| ||||||||||||||||||||||| |||||||||| | ||||||||||||||| ||||| |
|
|
| T |
14684269 |
aggggccggggttcgaacttcggacaccccacttattcatcttataaggtgaat---tatagccactaggctacctgacc |
14684193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 25139943 - 25139898
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||| ||| |||||||||||||||| |
|
|
| T |
25139943 |
tgcaggggtcggggttcgaaccccgaacatcccacttattcatctt |
25139898 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 35253886 - 35253801
Alignment:
| Q |
133 |
taatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||| ||||||||| |||||||||| || |||||||||||||||||| || || ||||||| ||||||||||||||||| ||||| |
|
|
| T |
35253886 |
taatatatgcaggggttggggttcgaatcc-ggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacctgacc |
35253801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 35301219 - 35301141
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||| || || ||||||| |||||||||||| |||| |||| |
|
|
| T |
35301219 |
tgcaggggtcggggttcgaactccggacaccctacttattcactttaaaagtgaatt--tctagccactagactacctgac |
35301141 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 44444557 - 44444622
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44444557 |
ctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccggacaccccactt |
44444622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 12736193 - 12736313
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa-ccccggacaccccacttattcatcttta--aggtgaatttc |
198 |
Q |
| |
|
|||||||| |||| |||||||||| | |||| ||| |||||||||||||||||||| |||| ||||| || ||||||||||||| ||||||||| |
|
|
| T |
12736193 |
tgagcttagctcagttggtaaggacgttacatattatatgcaggggtcggggttcgaacccccaaacacctcatttattcatctttatgaggtgaatt-- |
12736290 |
T |
 |
| Q |
199 |
tctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||| |||| |
|
|
| T |
12736291 |
tctagccattaggctactagacc |
12736313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 145 - 196
Target Start/End: Original strand, 14683920 - 14683972
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| ||| ||||||||||| |
|
|
| T |
14683920 |
gggtcggggttcgaaccccggacatcccacttattcaccttataaggtgaatt |
14683972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 196
Target Start/End: Complemental strand, 17987524 - 17987448
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| || || |||||||| ||| ||||||||||||||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
17987524 |
aggataatgcattattatatgcaggggccggagttcgaaccccggacaccccaattattcaccttataaggtgaatt |
17987448 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 166
Target Start/End: Original strand, 33617976 - 33618040
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||||||| |||||||||||||| |
|
|
| T |
33617976 |
tgagcttaactcagttggtagggatattgcatattatatgcaggggtcggtgttcgaaccccgga |
33618040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 122 - 196
Target Start/End: Complemental strand, 34073314 - 34073238
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| || || || ||||||| |||||||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
34073314 |
aggataatgcattattatatgtaggggtcaaggttcgaaccccggacaccccacttattcaccttataaggtgaatt |
34073238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 215
Target Start/End: Original strand, 7603787 - 7603849
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
7603787 |
gggttcaaaccccggacaccccacttattcatcttatagggtgaat---tctagccactaggctac |
7603849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 8953935 - 8953868
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| | || |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
8953935 |
tgagcttaacacagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacac |
8953868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 146 - 181
Target Start/End: Complemental strand, 14010822 - 14010787
Alignment:
| Q |
146 |
ggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
14010822 |
ggtcggggttcgaaccccggacaccccacttattca |
14010787 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 176
Target Start/End: Complemental strand, 17072638 - 17072555
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| | || |||||| | ||| |||||| ||| |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
17072638 |
caatccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccactt |
17072555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 17575633 - 17575716
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| | || |||||| | ||| |||||| ||| |||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
17575633 |
caatccccgtgagcttagcacagttggtaggtatattgcatattatatgcaggggccggggttcgaaccccgaacaccccactt |
17575716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 197
Target Start/End: Original strand, 23239166 - 23239221
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||| ||| ||| |||||||| |
|
|
| T |
23239166 |
aggggtcggggtttgaaccccggacaccccacttattcaccttataaagtgaattt |
23239221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 144 - 220
Target Start/End: Complemental strand, 23857375 - 23857301
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||| ||||||||||||| ||||||||| ||||||||||||| || ||||||| ||||||||||||||||| |||| |
|
|
| T |
23857375 |
ggggccggggttcgaacctcggacacccgacttattcatcttatacggtgaat---tctagccactaggctacctgac |
23857301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 36359774 - 36359696
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||| ||||||| ||||||||||||||||||||| ||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
36359774 |
tgcaggggccggagttcgaatcccggacaccccacttattcaccttataaggtgaat---tctagccactagactacctgac |
36359696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 37708694 - 37708769
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||||| ||||| ||| |||||||| |||||||||||||||||||| ||||||| |
|
|
| T |
37708694 |
tgagcttagctcaattggtagggataagtgcattttatatgcaggggccggggttcgaaccccggacatcccactt |
37708769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 38955260 - 38955193
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
38955260 |
tgagcttaactcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacac |
38955193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 89 - 168
Target Start/End: Original strand, 43656027 - 43656106
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
||||| ||| || |||||||| |||| |||||| ||||| |||||| ||| || ||||||||||||||||||| |||||| |
|
|
| T |
43656027 |
aaatctatccccgtgagcttagctcagttggtagggatattgcatattatatgtaggggtcggggttcgaacctcggaca |
43656106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 94577 - 94503
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||| ||||||||||||||||| |||||| |
|
|
| T |
94577 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggacactccactt |
94503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 1342603 - 1342676
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| |||||| |||| ||||||||||||||||||||| ||||||| |
|
|
| T |
1342603 |
tgagcttagctcaattgatatggatactgcatattatgtgaaggg-tcggggttcgaaccccggacatcccactt |
1342676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 1937314 - 1937388
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |||| |||||| |
|
|
| T |
1937314 |
tgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccgcacactccactt |
1937388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 6280484 - 6280558
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
6280484 |
tgagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccactt |
6280558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 6659293 - 6659367
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
6659293 |
tgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
6659367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 6739695 - 6739769
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
6739695 |
tgagattagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
6739769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 7194266 - 7194340
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
7194266 |
tgagcttagttcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
7194340 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 10200747 - 10200673
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
10200747 |
tgagcttagctcagttggtagagatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
10200673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 10573105 - 10573179
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| ||||||||| ||||||||||||||| |||| |||||| |
|
|
| T |
10573105 |
tgagtttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccgaacactccactt |
10573179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 11875890 - 11875964
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
11875890 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactt |
11875964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 11890897 - 11890971
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
11890897 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactt |
11890971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 13105095 - 13105169
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||| |||||||||||| |||| ||| ||||||||||||| | |||||||||||| |
|
|
| T |
13105095 |
tgagattaactcagttggtagggacaatgcataatatatgcaagggccggggttcgaacctcagacaccccactt |
13105169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 17698526 - 17698600
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||||||||| |||||| |
|
|
| T |
17698526 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccactt |
17698600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 17980321 - 17980359
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
17980321 |
tgcaggggccggggttcgaaccccggacaccccacttat |
17980359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 25890470 - 25890396
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | |||||| ||| | |||||||| | |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
25890470 |
tgagcttagcttagttggtagggacattgcataatttatgcaagggccggggttcgaaccccggacaccccactt |
25890396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 27558964 - 27558849
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttct |
199 |
Q |
| |
|
||||| || ||||||||||| ||||||||||| || || ||||||||||||| |||||| ||| ||||||||||||||||| ||| | |||||||| | |
|
|
| T |
27558964 |
tgagcgtagctcatttggta-ggataatgcattattatatgcaggggtcgggattcgaa-cccagacaccccacttattcaccttattaggtgaat---t |
27558870 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| |||| |||| |
|
|
| T |
27558869 |
ctagccactagtctacctgac |
27558849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 28909469 - 28909543
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| || |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
28909469 |
tgagcttagctcagttggtagggatattgcatattacatgcaggagccggggttcgaaccccggacactccactt |
28909543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 29734071 - 29733997
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||||||||| || ||| ||| |||||| |||||||||||||||||||| || |||||| |
|
|
| T |
29734071 |
tgagtttaactcagttggtaaggatattgtatattatatgcaggagtcggggttcgaaccccggatactccactt |
29733997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 31451023 - 31450949
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||| |||||||| |||||| |
|
|
| T |
31451023 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagccggggttcgaactccggacactccactt |
31450949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 34472301 - 34472375
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| || |||||||||||||| ||||| |||||| |
|
|
| T |
34472301 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagttggggttcgaaccccagacactccactt |
34472375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 35939491 - 35939565
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||| |||| ||||||||||||| |
|
|
| T |
35939491 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcaaaccgtggacaccccactt |
35939565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 36540291 - 36540365
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||||||||||||||||||||| |||| |||||| |
|
|
| T |
36540291 |
tgagcttaactcagttggtagggatattgcattttatatgcaggggtcggggttcgaaccccaaacactccactt |
36540365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 37290926 - 37291000
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || | ||| || ||||| |||||| ||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
37290926 |
tgagcttaacttagttgatagggatattgcatattatatgcaggggccggcgttcgaaccccggacaccccactt |
37291000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 117 - 179
Target Start/End: Complemental strand, 38210830 - 38210768
Alignment:
| Q |
117 |
tggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||| ||| ||||||| |||| |||| ||||| |
|
|
| T |
38210830 |
tggtaaggatattgcataatatatgcaggggtcggagtttgaaccccagacatcccatttatt |
38210768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 39362269 - 39362343
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||| ||| || ||||||||||| |||||||||||| |
|
|
| T |
39362269 |
tgagcttagctcagttggtagggatattgcatattatatgcagaggttggagttcgaaccccagacaccccactt |
39362343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 220
Target Start/End: Complemental strand, 42762086 - 42762010
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| ||||| || ||||||||||||||||||||| | ||||||||||| |||||||||||| |||| |||| |
|
|
| T |
42762086 |
tgcaggggtcgaggttcaaatcccggacaccccacttattca-ccttaaggtgaat---tctagccactagactacctgac |
42762010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 42880952 - 42881026
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||| | ||||||||||||||||||||| |||||| |
|
|
| T |
42880952 |
tgagcttaactcagttggtagggatattgcatattatatgtaggagccggggttcgaaccccggacactccactt |
42881026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 574264 - 574304
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
574264 |
tgcaggggtcggggttcgaaccccggaca-cccacttattca |
574304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 5184943 - 5184886
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||| ||| ||||||||||| |
|
|
| T |
5184943 |
tgcaggggctggggttcgaaccctggacaccccacttattcaccttataaggtgaatt |
5184886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 6064416 - 6064473
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||||||| ||| ||||||||||| |
|
|
| T |
6064416 |
tgcaggggtcggggttcgaacctcggacacttcacttattcagcttataaggtgaatt |
6064473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 7314772 - 7314813
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
7314772 |
tgcaggggccgaggttcgaaccccggacaccccacttattca |
7314813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 91 - 176
Target Start/End: Original strand, 7797123 - 7797208
Alignment:
| Q |
91 |
atcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| || | |||||| |||| |||||| ||||| || ||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
7797123 |
atcaatccccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccactt |
7797208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 9524996 - 9525053
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
9524996 |
tgcaggggccggggttcgaaccccagacaccctacttattcaccttataaggtgaatt |
9525053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 10199798 - 10199741
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||||||| ||| ||||||||||| |
|
|
| T |
10199798 |
tgcaggggccggggttcgaaccccaaacaccccacttattcaccttataaggtgaatt |
10199741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 221
Target Start/End: Complemental strand, 10557563 - 10557445
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| |||| | |||| |||||||||| |||||||| || |||| ||||| |||||||||||||||| || ||| ||| |||||| || |
|
|
| T |
10557563 |
tgagcttagctcaattggcagcgatattgcataatatatgcaggggccgtggtttgaacctcggacaccccacttatccaccttaaaagttgaatt--tc |
10557466 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| |||||||||| |
|
|
| T |
10557465 |
tagccactatactacttgacc |
10557445 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 13702408 - 13702351
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||| | |||||| |||||||||| ||| ||||||||||| |
|
|
| T |
13702408 |
tgcaggggtcggggttcgaacctcagacacctcacttattcaccttataaggtgaatt |
13702351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 24608539 - 24608482
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||||| ||||||| ||||||||| ||| ||||||||||| |
|
|
| T |
24608539 |
tgcaggggccggggttcgaaccccagacaccctacttattcaccttataaggtgaatt |
24608482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 25824959 - 25824894
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||| | |||||||| | |||| ||||||||||||||||||| |||||||||||| |
|
|
| T |
25824959 |
ctcaattggtagggacattgcataatttatgcaagggtcggggttcgaaccccagacaccccactt |
25824894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 30942655 - 30942598
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| |||||||||||||||| |||||||||||||| | ||| ||||||||||| |
|
|
| T |
30942655 |
tgcaggggccggggttcgaaccccgaacaccccacttatttaccttataaggtgaatt |
30942598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 32822113 - 32822233
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| | | | ||||| || ||||||||||| |||| |||||| ||||| |||||||||||||| |
|
|
| T |
32822113 |
ccatgagcttaactcatttggtaagggataatgcatt-tgtatataggggcgggagttcgaaccccagacatcccactcattcacttttaaggtgaattt |
32822211 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
|||| || ||| ||||||||| |
|
|
| T |
32822212 |
ctctggcagctatgctacttga |
32822233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 149 - 197
Target Start/End: Original strand, 33524444 - 33524493
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattca-tctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||| |||||| ||||| |
|
|
| T |
33524444 |
cggggttcgaaccccggacaccccacttattcactctataaggttaattt |
33524493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 33982229 - 33982270
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||| |||||| |||||||||| |
|
|
| T |
33982229 |
tgcaggggtcggggttcgaaccccagacaccgcacttattca |
33982270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Original strand, 34266017 - 34266090
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||||| ||||| |||||| ||| |||||| || |||||||||||| ||||||| |||||| |
|
|
| T |
34266017 |
gagcttagctcagttggtagggatattgcatattatatgcaggagttggggttcgaacctcggacactccactt |
34266090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 34873115 - 34873164
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
34873115 |
aatgcattttatatgcaggggtcggggttcgaacctcggacaccccactt |
34873164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Complemental strand, 36035220 - 36035171
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||| |||||||||||||| |
|
|
| T |
36035220 |
aatgcattttatatgcaggggtcggggttcgaacctcggacaccccactt |
36035171 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 39258629 - 39258697
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| || |||||||||||||||||||||| |||||| ||| ||||||||||||||||| |||| |
|
|
| T |
39258629 |
ggggttcgaatcctggacaccccacttattcatcttataaggtaaat---tctagccactaggctacctgac |
39258697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 143 - 220
Target Start/End: Original strand, 41375529 - 41375606
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||| |||| ||||||||| |||| |||| |||||| ||||||||||| ||| |||||||||||||| |
|
|
| T |
41375529 |
aggggttggggtttgaactccggacacctcactatttcacctttaaagtgaatttctccagctgctaggctacttgac |
41375606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 5683760 - 5683832
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| | ||| |||||| ||| ||||||||| |||||||||||||| ||||||| |||| |
|
|
| T |
5683760 |
agcttagctcaattggtaggaatattgcatattatatgcaggggttggggttcgaaccccagacaccctactt |
5683832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 92 - 176
Target Start/End: Original strand, 7453346 - 7453430
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| || |||| ||| |||| ||||| ||||| ||||| ||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
7453346 |
tcaatccccgtgagtttagctcagctggtagggatattgcattttatatgtaggggccggggttcgaaccccggacaccccactt |
7453430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 28219864 - 28219931
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||| ||||||||||||||||||| |||| |||| |||||||||||||| ||||| |
|
|
| T |
28219864 |
tgagcttagctcagttgttaaggataatgcataatatttgca-aggtccgggttcgaaccccgaacacc |
28219931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 128 - 176
Target Start/End: Original strand, 30300359 - 30300407
Alignment:
| Q |
128 |
atgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||||||| |||| |||| |
|
|
| T |
30300359 |
atgcataatatatgcaggggccggggttcgaaccccggaaaccctactt |
30300407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 150 - 221
Target Start/End: Complemental strand, 38790618 - 38790549
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||| ||||||||||||||||| || || ||||||| ||||| ||||||||||| ||||| |
|
|
| T |
38790618 |
ggggttcgaaccccagacaccccacttattcactttaaaagtgaatt--tctaggcactaggctacctgacc |
38790549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 176
Target Start/End: Complemental strand, 1337162 - 1337107
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
1337162 |
aaggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
1337107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 1632506 - 1632439
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| | ||| | |||| ||| |||||| ||||||||||||||||||||||| |
|
|
| T |
1632506 |
tgagcttagctcagttggtaggaatattacatattatatgcaggagtcggggttcgaaccccggacac |
1632439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 2294165 - 2294094
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||| ||| |||| ||| || ||||| | |||| ||| |||||||||||||||||||||||| ||||||||| |
|
|
| T |
2294165 |
tgagtttagctcaattgatagggatattacatattatatgcaggggtcggggttcgaaccccagacacccca |
2294094 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 175 - 210
Target Start/End: Complemental strand, 3956766 - 3956731
Alignment:
| Q |
175 |
ttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3956766 |
ttattcacctttaaggtgaatttctctagccactag |
3956731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 199
Target Start/End: Original strand, 5323961 - 5324020
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||||||||||||||||||||| || || ||||||| || || |||||||||| |
|
|
| T |
5323961 |
tgcaggggtcggggttcgaaccccggactcctcagttattcactttaaaagtgaatttct |
5324020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #169
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 14583200 - 14583275
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| || |||||||||| |||||||| |||||||||||| || ||||||||||| |
|
|
| T |
14583200 |
tgagcttaactcagttggtagggacaaatgcataatatatgcaggggctggggttcgaaccacgaacaccccactt |
14583275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #170
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 121 - 200
Target Start/End: Complemental strand, 15187433 - 15187354
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
||||| |||||| ||||| |||| |||| ||||||||||| || |||||||||||||||| ||| || || |||||||| |
|
|
| T |
15187433 |
aaggacaatgcacaatatatgcacgggttggggttcgaactccaaacaccccacttattcaccttaaacgtaaatttctc |
15187354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #171
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 142 - 181
Target Start/End: Original strand, 16935628 - 16935667
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
16935628 |
caggggttggggttcgaaccccagacaccccacttattca |
16935667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #172
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 18942919 - 18942986
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||||| |||| || |||| ||| |||||||||||| |
|
|
| T |
18942919 |
tgagcttagctcagttggtagggataatgcataatatatgcatggtccgggtttcaaaccccggacac |
18942986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #173
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 22717822 - 22717869
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | |||||||| || ||||||||||||||||||||||||| |
|
|
| T |
22717822 |
tgcataatttatgcaggggccgaggttcgaaccccggacaccccactt |
22717869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #174
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 23339962 - 23339883
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| |||| || ||| ||| || ||||| |||||||||||||| ||||||||||||| |||| |
|
|
| T |
23339962 |
tgagcttaactcagttggtagagatattgtatattatatgtaggggccggggttcgaaccctggacaccccacttcttca |
23339883 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #175
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 153 - 221
Target Start/End: Original strand, 24074558 - 24074624
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| |||||||| |||||||||| ||| ||||||||||| |||||||||||||||| ||||| |
|
|
| T |
24074558 |
gttcgaacctcggacacctcacttattcaccttataaggtgaatt---ctagccactaggctacctgacc |
24074624 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #176
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 26567314 - 26567247
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||| |||||| |||||||||||||||| |
|
|
| T |
26567314 |
tgagcttagctcagttgatagggatattgcatattatatgcaggagtcgggattcgaaccccggacac |
26567247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #177
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 29260623 - 29260690
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| ||||| ||||| |||||| ||| |||||| ||||||| ||||||||||||||| |
|
|
| T |
29260623 |
tgagcttaactcagctggtagggatattgcatattatatgcaggagtcggggctcgaaccccggacac |
29260690 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #178
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 30623294 - 30623361
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || ||||||||||||||| |||| |
|
|
| T |
30623294 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtctggggttcgaaccccgaacac |
30623361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #179
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 146 - 185
Target Start/End: Original strand, 35779798 - 35779837
Alignment:
| Q |
146 |
ggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
35779798 |
ggtcggggttcgaacctaggacaccccacttattcatctt |
35779837 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #180
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 172
Target Start/End: Original strand, 40393349 - 40393392
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacacccc |
172 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||| ||||||| |
|
|
| T |
40393349 |
tgcataatttatgcaggggtcggggttcgaaccccgaacacccc |
40393392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #181
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 43284032 - 43283965
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |
|
|
| T |
43284032 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacac |
43283965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #182
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 43980379 - 43980312
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| ||| ||| || ||||| |||||| ||| ||||||| |||||||||||||||||||||| |
|
|
| T |
43980379 |
tgagcttagttcagttgttagggatattgcatattatatgcagggatcggggttcgaaccccggacac |
43980312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #183
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 172 - 219
Target Start/End: Complemental strand, 44010451 - 44010404
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||||||||||||||||||| ||||||||| |||||| |||||||| |
|
|
| T |
44010451 |
cacttattcatctttaaggtggatttctctaaccactatactacttga |
44010404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #184
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 133419 - 133493
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||| |||||||||||||| ||| |||| |||||| |
|
|
| T |
133419 |
tgagcttagctcagttgatagggatattgcatattatatgcaggagtcggggttcgaactccgaacactccactt |
133493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #185
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 99 - 181
Target Start/End: Original strand, 1503911 - 1503992
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||| |||| |||| | ||||| || ||| ||| |||||| | ||||||||||||||| |||||||||||| |||| |
|
|
| T |
1503911 |
ccatgagcttagctcagttggcagggatattg-atattatatgcaggagccggggttcgaaccccagacaccccacttcttca |
1503992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #186
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 5332920 - 5332994
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| |||| | ||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
5332920 |
tgagcttagctcagttggtagagatattatatattatatgcaggagtcggggttcgaaccccggacactccactt |
5332994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #187
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 152 - 215
Target Start/End: Complemental strand, 8740700 - 8740639
Alignment:
| Q |
152 |
ggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||| |||||||||| ||||||||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
8740700 |
ggttcgaactccggacaccctacttattcatcttataaggtgaat---tctagccactaagctac |
8740639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #188
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 160
Target Start/End: Complemental strand, 8971574 - 8971520
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaac |
160 |
Q |
| |
|
|||| ||||||||||||||||| | |||| ||| |||||||||||||||| |||| |
|
|
| T |
8971574 |
cttacctcatttggtaaggatattacatattatatgcaggggtcggggtttgaac |
8971520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #189
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 104 - 162
Target Start/End: Complemental strand, 9635111 - 9635053
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||| |||| || ||||||||||||||||||| |||| || ||||||||||||||| |
|
|
| T |
9635111 |
agcttagctcagtttgtaaggataatgcataatacatgcaaggttcggggttcgaaccc |
9635053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #190
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 10568089 - 10568163
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| || |||||||| |||||| |||||||||||||||||||| |
|
|
| T |
10568089 |
tgagtttagctcagttggtagggatattgcatattaaatgcaggggaaggggtttgaaccccggacaccccactt |
10568163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #191
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 122 - 220
Target Start/End: Original strand, 10970286 - 10970383
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||| || || |||||||| ||||||| ||||||| |||||||||||||||| ||| |||| ||||| ||||||||||||| ||| ||| |
|
|
| T |
10970286 |
aggataatgcattattatatgcaggggctggggttcaaaccccgaacaccccacttattcaccttataagatgaat---tctagccactaggttacctga |
10970382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #192
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 181
Target Start/End: Original strand, 11823004 - 11823042
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
11823004 |
aggggccggggtttgaaccccggacaccccacttattca |
11823042 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #193
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 14012651 - 14012709
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
|||||||| ||||||||||| |||||||||||||||||||| || |||||||||||| |
|
|
| T |
14012651 |
tgcaggggccggggttcgaagtccggacaccccacttattcacattataaggtgaattt |
14012709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #194
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 14876668 - 14876594
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||| ||| |||||| | ||||||||||||| ||||||| |||||| |
|
|
| T |
14876668 |
tgagcttagctcagttggtagggaaattgcatattatatgcaggagccggggttcgaacctcggacactccactt |
14876594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #195
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17027946 - 17027873
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||| || | ||||||||||| |||||||||||||||| |
|
|
| T |
17027946 |
tgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaa-cccggacaccccactt |
17027873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #196
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 151 - 181
Target Start/End: Original strand, 17467327 - 17467357
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
17467327 |
gggttcgaaccccggacaccccacttattca |
17467357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #197
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 17558382 - 17558309
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||| || | ||||||||||| |||||||||||||||| |
|
|
| T |
17558382 |
tgagcttagctcagttggtagggatattgcatattatatgccggagccggggttcgaa-cccggacaccccactt |
17558309 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #198
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 20872524 - 20872450
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||| | |||||||| | |||||||||||| ||||||| |||| ||||||||||| |
|
|
| T |
20872524 |
tgagcttagctcagttgatagggacattgcataatttatgcaggggtcggagttcgaatcccgaacaccccactt |
20872450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #199
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 23435299 - 23435225
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| || ||||| |||||| ||| |||||| | |||||||||||||||||| || |||||| |
|
|
| T |
23435299 |
tgagcttagctcagttgatagggatattgcatattatatgcaggagccggggttcgaaccccggatactccactt |
23435225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #200
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 28420490 - 28420416
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| | ||| |||||| ||| ||| || | ||||||||||||||||||||| |||||| |
|
|
| T |
28420490 |
tgagcttagctcagttggtaggaatattgcatattatatgctggagccggggttcgaaccccggacactccactt |
28420416 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #201
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 32328091 - 32328053
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32328091 |
cacttattcatctttaagctgaatttttctagccactag |
32328053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #202
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Complemental strand, 34158723 - 34158661
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||| |
|
|
| T |
34158723 |
tgagcttagctcagttggtagggatattgcatattatatgcaggaggcggggttcgaaccccg |
34158661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #203
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 38344053 - 38344127
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||| ||||| |||||| |
|
|
| T |
38344053 |
tgagcttaactcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccagacactccactt |
38344127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #204
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 41616432 - 41616358
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| || ||| ||| |||||||| |||||||||||||||||| || |||||| |
|
|
| T |
41616432 |
tgagcataactcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccggatactccactt |
41616358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #205
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 196
Target Start/End: Original strand, 42688098 - 42688152
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||||||| | ||| ||||||||||| |
|
|
| T |
42688098 |
aggggtcgggattcgaaccccgaacaccccacttatttaccttataaggtgaatt |
42688152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #206
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 178
Target Start/End: Original strand, 43847741 - 43847779
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||||||||||||||| ||||||||||||| |
|
|
| T |
43847741 |
tgcaggggccggggttcgaaccccgaacaccccacttat |
43847779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #207
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 44340411 - 44340337
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||| |||||| |||||||||||||||| |||||| |
|
|
| T |
44340411 |
tgagcttagctcagttggtagggatattgcatattataaacaggagtcgggattcgaaccccggacactccactt |
44340337 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #208
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 44673714 - 44673640
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||| ||| |||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44673714 |
tgagcttagctcagttggtagggatatcacattttatatgcaggggtcggggttcgaaccccagacactccactt |
44673640 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #209
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 220418 - 220377
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
220418 |
tgcagaggtcagggttcgaatcccggacaccccacttattca |
220377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #210
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 689573 - 689532
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
689573 |
tgcagaggtcagggttcgaatcccggacaccccacttattca |
689532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #211
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 734041 - 734000
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
734041 |
tgcagaggtcagggttcgaatcccggacaccccacttattca |
734000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #212
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 857937 - 857896
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
857937 |
tgcagaggtcagggttcgaatcccggacaccccacttattca |
857896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #213
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 2376557 - 2376598
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||| ||||||||||| ||||||| ||||||||||| |
|
|
| T |
2376557 |
tgcaggggtccgggttcgaacctcggacactccacttattca |
2376598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #214
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 176
Target Start/End: Original strand, 3828362 - 3828395
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||||||||||||||||||||||||| |
|
|
| T |
3828362 |
aggggtcagggttcgaaccccggacaccccactt |
3828395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #215
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 101 - 170
Target Start/End: Complemental strand, 6851093 - 6851024
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||||||| |||| |||||| || | |||||||| | ||||||||| ||| ||||||||||||||||| |
|
|
| T |
6851093 |
atgagcttaactcaattggtagagacattgcataatttatgcaggggtagggattcgaaccccggacacc |
6851024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #216
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 6942576 - 6942523
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
6942576 |
ggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
6942523 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #217
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 7540544 - 7540503
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||| ||||| ||||| |||||||||||| |
|
|
| T |
7540544 |
tgcaggggtcggggttctaaccctggacaacccacttattca |
7540503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #218
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 7649577 - 7649645
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| || |||||||||||||||| ||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
7649577 |
ggggttcgaacctcgaacaccccacttattcaccttacaaggtgaat---tctagccactaggctacctgac |
7649645 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #219
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 7764004 - 7763931
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| |||| |||||| |||| |||||| ||| |||||||| |||| || |||| ||||||||||||||| |
|
|
| T |
7764004 |
gagcttagctcagttggtagagatattgcatattatatgcaggggccgggatttgaactccggacaccccactt |
7763931 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #220
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 91 - 176
Target Start/End: Original strand, 7816396 - 7816481
Alignment:
| Q |
91 |
atcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| || | |||||| |||| |||||| ||||| || ||| ||| |||||| | ||||||||||||| ||||||| |||||| |
|
|
| T |
7816396 |
atcaatccccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaacctcggacactccactt |
7816481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #221
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 8034569 - 8034610
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||| | |||||||||||||||| |||||||||||||||| |
|
|
| T |
8034569 |
tgcaggagccggggttcgaaccccgaacaccccacttattca |
8034610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #222
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 159
Target Start/End: Original strand, 12927803 - 12927864
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
||||||||||| ||||||| ||| || |||||||| ||| ||||||||| |||||||||||| |
|
|
| T |
12927803 |
ccatgagcttaactcatttagtaggggataatgcacaatttgtgcagggttcggggttcgaa |
12927864 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #223
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 13647514 - 13647449
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| |||| |||||| ||| |||||| |||| |||||||||||||||||| |||||| |
|
|
| T |
13647514 |
ctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccactt |
13647449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #224
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 13747939 - 13747874
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| |||| |||||| ||| |||||| |||| |||||||||||||||||| |||||| |
|
|
| T |
13747939 |
ctcagttggtagagatattgcatattatatgcaggagtcgtggttcgaaccccggacactccactt |
13747874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #225
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 13762568 - 13762527
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||| | ||||||||| ||||||||||||||||||| |
|
|
| T |
13762568 |
tgcaggggtcagtgttcgaaccacggacaccccacttattca |
13762527 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #226
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 14011094 - 14011049
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||| ||| ||||||||| |||||| |||||||||||||||| |
|
|
| T |
14011094 |
tgcaggggccggagttcgaacctcggacatcccacttattcatctt |
14011049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #227
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 159
Target Start/End: Original strand, 19778066 - 19778123
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaa |
159 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || ||||||||||| |
|
|
| T |
19778066 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaa |
19778123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #228
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 143
Target Start/End: Original strand, 23816791 - 23816832
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgca |
143 |
Q |
| |
|
|||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
23816791 |
tgagcttagctcagttggtaaggataatgcataatatatgca |
23816832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #229
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 24480886 - 24480813
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||| |||||| |||| || ||| ||| |||||||| |||||||||||| ||||||||||||| |
|
|
| T |
24480886 |
gagcttatctcagttggtagagatattgtatattatatgcaggggctggggttcgaaccttggacaccccactt |
24480813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #230
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 25119247 - 25119288
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||| ||||| |
|
|
| T |
25119247 |
tgcaggggttggggttcgaaccccggacatcccactcattca |
25119288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #231
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 26703946 - 26703889
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||| ||||||||||||||| |||| ||||| |||||||||| ||| ||||||||||| |
|
|
| T |
26703946 |
tgcaagggtcggggttcgaatcccgaacacctcacttattcaccttataaggtgaatt |
26703889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #232
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 31153064 - 31153011
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| || ||||||| |||||||||||| ||||||||||||| |
|
|
| T |
31153064 |
ggatattgcatattatatgtaggggtcagggttcgaaccctggacaccccactt |
31153011 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #233
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 33810669 - 33810718
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
33810669 |
aatgcattttatatgcaggggccggggttcaaaccccggacaccccactt |
33810718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #234
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 37154553 - 37154610
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||| ||||||| ||| ||||||||||| |
|
|
| T |
37154553 |
tgcaggggtcggaattcgaaccctggacaccccatttattcaccttataaggtgaatt |
37154610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #235
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 39432384 - 39432343
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| |||||||||||| | ||||||||||||||||| |
|
|
| T |
39432384 |
tgcaggggttggggttcgaacctcagacaccccacttattca |
39432343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #236
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 39674086 - 39674045
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||| |||| |
|
|
| T |
39674086 |
tgcaggggttggggttcgaaccctggacaccccacttcttca |
39674045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #237
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 188
Target Start/End: Original strand, 40103522 - 40103606
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa |
188 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||| ||||| ||||||| | ||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
40103522 |
tgagcttagctcatttgataagggataatgcacaatataagcaggggctgaggttcgaaccc---acaccccacttattcatatttaa |
40103606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #238
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 143 - 176
Target Start/End: Complemental strand, 42801674 - 42801641
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||| |||||||||||||| |
|
|
| T |
42801674 |
aggggtcggggttcgaacctcggacaccccactt |
42801641 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #239
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 170
Target Start/End: Complemental strand, 1244761 - 1244697
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| |||| |||||||||| |||||||||||| | || || ||||||||||||||||||||| |
|
|
| T |
1244761 |
cttagctcagttggtaaggacaatgcataatatatacaaggtctggggttcgaaccccggacacc |
1244697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #240
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 129 - 185
Target Start/End: Complemental strand, 2279590 - 2279534
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||| ||||||||||| |||||||||| | || | ||||| |||||||||| |
|
|
| T |
2279590 |
tgcataatatatgcaggggtcgaggttcgaacctcagatatcccacatattcatctt |
2279534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #241
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 111 - 174
Target Start/End: Complemental strand, 3190006 - 3189945
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| |||||||||||||||||||||| |||| |
|
|
| T |
3190006 |
ctcagttggtagggatattgcatattatatgcagg--tcggggttcgaaccccggacactccac |
3189945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #242
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 144 - 176
Target Start/End: Complemental strand, 7623726 - 7623694
Alignment:
| Q |
144 |
ggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||||| |
|
|
| T |
7623726 |
ggggtcggggttcgaacccaggacaccccactt |
7623694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #243
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 104 - 176
Target Start/End: Complemental strand, 10587341 - 10587269
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||| ||||| | ||||||| ||||||||||||||| |
|
|
| T |
10587341 |
agcttagctcagttggtagggatattgcatattatatgcaaaggtcgagattcgaactccggacaccccactt |
10587269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #244
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 12926525 - 12926489
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
12926525 |
cggggttcgaatcccggacacctcacttattcatctt |
12926489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #245
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 24296934 - 24296874
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||||| |||| || ||| ||||| |||||| ||| ||||||||| ||||||||||||| |
|
|
| T |
24296934 |
tgagcttagctcagttagtagggatattgcatattatatgcaggggttggggttcgaaccc |
24296874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #246
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 166
Target Start/End: Original strand, 24458321 - 24458385
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccgga |
166 |
Q |
| |
|
|||||||| |||| |||| | ||||| || ||| ||| |||||||| |||||||||||||||||| |
|
|
| T |
24458321 |
tgagcttagctcagttggaagggatattgtatattatatgcaggggccggggttcgaaccccgga |
24458385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #247
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Complemental strand, 24790376 - 24790316
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||||| | |||| ||| || |||||| ||||||||||||| ||||||||||||| |
|
|
| T |
24790376 |
ttggtagggatattacatattatatgtaggggttggggttcgaaccctggacaccccactt |
24790316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #248
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 145 - 181
Target Start/End: Complemental strand, 25470897 - 25470861
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||| |
|
|
| T |
25470897 |
gggtcggggttcgaacctcggacaccccatttattca |
25470861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #249
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 106 - 173
Target Start/End: Original strand, 26395372 - 26395440
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtc-ggggttcgaaccccggacacccca |
173 |
Q |
| |
|
||||||||| ||| |||||||| ||||| ||| |||||||| | |||||||||||||| ||||||||| |
|
|
| T |
26395372 |
cttatctcagttgataaggatattgcattttatatgcagggggctggggttcgaaccccagacacccca |
26395440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #250
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 176
Target Start/End: Original strand, 28300119 - 28300163
Alignment:
| Q |
132 |
ataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
28300119 |
ataatttgtgcaggggccggggttcgaaccccggattccccactt |
28300163 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #251
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 164
Target Start/End: Original strand, 32192909 - 32192957
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||| ||| |||||||||||| |||| || ||||||||||||||||| |
|
|
| T |
32192909 |
ttggtatggacaatgcataatatatgcaaggttcggggttcgaaccccg |
32192957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #252
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 34812555 - 34812519
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34812555 |
tgcaggggctggggttcgaaccccggacaccccactt |
34812519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #253
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 38107502 - 38107466
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
38107502 |
tgcaggggccggggttcgaaccccagacaccccactt |
38107466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #254
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 38283166 - 38283202
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||||||| |||||||||||| |
|
|
| T |
38283166 |
tgcaggggccggggttcgaaccccagacaccccactt |
38283202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #255
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 171 - 199
Target Start/End: Original strand, 41430886 - 41430914
Alignment:
| Q |
171 |
ccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41430886 |
ccacttattcatctttaaggtgaatttct |
41430914 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #256
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 42761921 - 42761861
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca-tctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| |||||||||||| | |||||| ||||||||||| | | |||||||||||||| |
|
|
| T |
42761921 |
tgcagggggcggggttcgaactctggacactccacttattcactttataaggtgaatttct |
42761861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #257
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 43085251 - 43085215
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
43085251 |
tgcaggggccggggttcgaaccccggacactccactt |
43085215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 89; Significance: 6e-43; HSPs: 207)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 101 - 220
Target Start/End: Original strand, 34107494 - 34107613
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| |||||||||||||| |||||||| |||||||||||||||| |||||| ||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
34107494 |
atgagcttagctcatttggtaagggataatgcacaatatgtgcaggggtcagggttcaaaccc-ggacaccccacttattcatctttaaggtgaatttct |
34107592 |
T |
 |
| Q |
200 |
ctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
34107593 |
ctagccactaggctacttgac |
34107613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 88; E-Value: 2e-42
Query Start/End: Original strand, 99 - 217
Target Start/End: Complemental strand, 18424247 - 18424131
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||| |||||||||||||| |||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
18424247 |
ccatgagcttagctcatttggtaagga--atgcacaatatgtgcaggggccggggttcgaactccggacatcccacttattcatctttaaggtgaatttc |
18424150 |
T |
 |
| Q |
199 |
tctagccactaggctactt |
217 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
18424149 |
tctagccactaggctactt |
18424131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 82; E-Value: 8e-39
Query Start/End: Original strand, 101 - 221
Target Start/End: Complemental strand, 33065353 - 33065232
Alignment:
| Q |
101 |
atgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||| ||| |||| |||||||||||||||||| ||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
33065353 |
atgagcttagctcatttggcaagggataatgcacaatgtgtgtaggggtcggggttcgaactccgaacaccctacttattcatctttaaggtgaatttct |
33065254 |
T |
 |
| Q |
200 |
ctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
33065253 |
ctagccactaggctacttgacc |
33065232 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 3330299 - 3330177
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||| ||||| ||||||| |||||| |||||||| ||||||||||| |||||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3330299 |
ccatgtgcttaactcatttagtaagggataatgcacaatatgtgcagaggtcggagttcgaaccccggacaccccacttattcatctttaaggtgaattt |
3330200 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||| |||| ||||| |
|
|
| T |
3330199 |
ctctaaccactaagctatttgac |
3330177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 79; E-Value: 5e-37
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 41749944 - 41750065
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||| | ||||||||| |||| |||||||| ||| |||| ||||||||||||| ||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
41749944 |
ccatgagctaagctcatttggcaagggataatgcacaatgtgtgtaggggtcggggtttgaaccccggacaccc-acttattcatctttaaggtgaattt |
41750042 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| |
|
|
| T |
41750043 |
ctctagccactaggctacttgac |
41750065 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 18949782 - 18949661
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||||||| |||||||||||||||||||||||||||| | |||||| |||||||||| ||||| |||||||| |
|
|
| T |
18949782 |
ccatgagcttaactcatttgataacggataatgcattatatgtgcaggggtcggggttcgaaccctgaacacccaacttattcat-tttaatgtgaattt |
18949684 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||| ||||||||| |
|
|
| T |
18949683 |
ctctagccactagactacttgac |
18949661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 72; E-Value: 8e-33
Query Start/End: Original strand, 114 - 220
Target Start/End: Complemental strand, 17543173 - 17543066
Alignment:
| Q |
114 |
atttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||| |||||||| ||||||||||||||||||||||||||| |||| |||||||| ||||||||| |
|
|
| T |
17543173 |
atttggtaagggataatgcacaatatgtgcaggggccggagttcgaacgccggacaccccacttattcatctttaatgtgactttctctaaccactaggc |
17543074 |
T |
 |
| Q |
213 |
tacttgac |
220 |
Q |
| |
|
|||||||| |
|
|
| T |
17543073 |
tacttgac |
17543066 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 100 - 217
Target Start/End: Complemental strand, 19843460 - 19843342
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| ||||||| |||||| || ||| | |||||||||||||||| |||||||||||| |||||| ||||||||||||||||||||||||||| |
|
|
| T |
19843460 |
catgagcttaactcatttcgtaagggatgatgtacaatatgtgcaggggtcagggttcgaaccctagacacctcacttattcatctttaaggtgaatttc |
19843361 |
T |
 |
| Q |
199 |
tctagccactaggctactt |
217 |
Q |
| |
|
|||||| |||||||||||| |
|
|
| T |
19843360 |
tctagctactaggctactt |
19843342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 31149199 - 31149078
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||||| || |||||||||||||| |||||||| ||||||||||||| | | |||||||||||| |||||||||||| || ||||||||||||||||| |
|
|
| T |
31149199 |
ccatgagcatagctcatttggtaagggataatgcacaatatgtgcagggtt-gaggttcgaaccccagacaccccactttttaatctttaaggtgaattt |
31149101 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||| ||||||||||| |
|
|
| T |
31149100 |
ctctaaccacttggctacttgac |
31149078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 67; E-Value: 7e-30
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 42678422 - 42678300
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||| ||| || | ||||||||| |||||||| |||||| | |||| |||| ||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42678422 |
ccatgagtttaacttacttggtaagggataatgcacaatatgcgtagggatcggagttcgaaccccggacaccccacttattcatctttaaggtgaattt |
42678323 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| ||||||| |||||||| |
|
|
| T |
42678322 |
ctctaaccactagattacttgac |
42678300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 93 - 221
Target Start/End: Original strand, 43027146 - 43027275
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||| ||||||||||| |||||||| ||||| |||||||| ||| ||||| || | | |||||||||||| ||||||||| ||||||| ||||||||| |
|
|
| T |
43027146 |
caatccccatgagcttagctcatttgataagggataatgcacaatttgtgcgggtgctgaggttcgaaccccagacaccccatttattcacctttaaggt |
43027245 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||| |||||||||| |
|
|
| T |
43027246 |
gaatttctctagccactagactacttgacc |
43027275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 123 - 219
Target Start/End: Complemental strand, 5901904 - 5901808
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||| ||| | |||||||| |||||| | |||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
5901904 |
ggataatgcacaatttctgcaggggccggggtacaaaccccggacaccccacttattcatcttaaaggtgaatttctttagccactaggctacttga |
5901808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 24202150 - 24202270
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| ||||||||| || | |||||||| ||||||||||||||||||||||||||| |||| |||||||||||||||||| |
|
|
| T |
24202150 |
tgagcttagctcacttggtaagggataatgcattatgtatgcaggggccggggttcgaaccccggacaccccactatttcacctttaaggtgaatttctc |
24202249 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
|||| ||||||| ||||||| |
|
|
| T |
24202250 |
cagccgctaggctgcttgacc |
24202270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 121 - 220
Target Start/End: Original strand, 1962846 - 1962944
Alignment:
| Q |
121 |
aaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||| | | ||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |||||||| | |||||||||||||| |
|
|
| T |
1962846 |
aaggataatgcatattgtatgcaggggtcgaggttcgaactccggacaccccacttattcatctttaaggtgaa-ttctctagtcgctaggctacttgac |
1962944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 104 - 220
Target Start/End: Original strand, 6866510 - 6866627
Alignment:
| Q |
104 |
agcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||| |||||||||||||| |||||||| |||||||||||| ||| ||||||| |||||||||| |||||||| ||||||||||||||||||| || |
|
|
| T |
6866510 |
agcttaactcatttggtaagggataatgcacaatatgtgcaggaaccggagttcgaatcccggacacctcacttatttatctttaaggtgaatttcttta |
6866609 |
T |
 |
| Q |
203 |
gccactaggctacttgac |
220 |
Q |
| |
|
|||| ||| ||||||||| |
|
|
| T |
6866610 |
gccagtagactacttgac |
6866627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 123 - 220
Target Start/End: Complemental strand, 33613678 - 33613581
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||| ||| ||||||| ||||||||||||||||||||||||||||| ||||||| |||||||||||||| |||| |||||||||| |
|
|
| T |
33613678 |
ggataatgcatattatatgcgagggtcggagttcgaaccccggacaccccacttattcacctttaagttgaatttctctagctactatgctacttgac |
33613581 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 102 - 217
Target Start/End: Complemental strand, 25783308 - 25783193
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||| ||| |||||||||| ||| ||||||||| |||||||||||| |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
25783308 |
tgagcttagctcacttggtgagggataatgcata-tatatgcaggggttagggttcgaaccctggacaccccacttattcatcttcaaggtgaagttctc |
25783210 |
T |
 |
| Q |
201 |
tagccactaggctactt |
217 |
Q |
| |
|
|||||| |||||||||| |
|
|
| T |
25783209 |
tagccattaggctactt |
25783193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 29090416 - 29090534
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| ||||| || ||||| ||||||||| ||| | |||||| ||| |||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
29090416 |
tgagcttagctcatatgataagggataatgcatt-tatatacaggggccggagttcgaaccccggacacctcacttattcatctttaaggtgaatttctc |
29090514 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
|||| |||||||||||||| |
|
|
| T |
29090515 |
cagccgctaggctacttgac |
29090534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 100 - 209
Target Start/End: Complemental strand, 11069442 - 11069336
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| ||||||||||||||| ||||||| ||||||||||||| | ||||||||||||| |||||||| || ||||||||||| |||||||| |
|
|
| T |
11069442 |
catgagcttagctcatttggtaaggaataatgcacaatatgtgcagggtttggggttcgaaccctggacaccc----tactcatctttaagatgaatttc |
11069347 |
T |
 |
| Q |
199 |
tctagccacta |
209 |
Q |
| |
|
||||||||||| |
|
|
| T |
11069346 |
tctagccacta |
11069336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 42541194 - 42541275
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||| ||| ||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
42541194 |
tgcaggggctggggttcgaaccccagacaccccacttactcacctttaaggtgaatttctctagccgctaggctacttgacc |
42541275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 57; E-Value: 7e-24
Query Start/End: Original strand, 100 - 219
Target Start/End: Complemental strand, 40203376 - 40203256
Alignment:
| Q |
100 |
catgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttc |
198 |
Q |
| |
|
|||||||||| |||||| ||||||| |||||| | |||||||| | ||||| ||||| ||||||| || ||||||||||||||| |||||||| ||||| |
|
|
| T |
40203376 |
catgagcttagctcattcggtaagggataatgtacaatatgtgtaagggtcagggtttgaaccccagataccccacttattcatttttaaggtagatttc |
40203277 |
T |
 |
| Q |
199 |
tctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||| |||||||| |
|
|
| T |
40203276 |
tctagccactagactacttga |
40203256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 94 - 220
Target Start/End: Complemental strand, 33482745 - 33482618
Alignment:
| Q |
94 |
aatcaccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtg |
192 |
Q |
| |
|
|||| |||||| |||| ||||||||||||||| | ||||| ||||| ||||||| || |||||||||| | ||||||||||||||||||||||||| || |
|
|
| T |
33482745 |
aatccccatgaacttagctcatttggtaaggaatgatgcacaatatatgcagggaccgtggttcgaacctcagacaccccacttattcatctttaagatg |
33482646 |
T |
 |
| Q |
193 |
aatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||| ||| || ||||||||| |
|
|
| T |
33482645 |
aatttctctaaccatcagactacttgac |
33482618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 101 - 221
Target Start/End: Original strand, 17269911 - 17270032
Alignment:
| Q |
101 |
atgagcttatctcatttggta-aggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||||| ||||||||||| || |||||||| ||| | || |||||||||| ||||||| | | |||||| ||||||||||| | ||||||||||||| |
|
|
| T |
17269911 |
atgagcttagctcatttggtagagaataatgcacaatttatgtaggggtcgggattcgaacgctgaacacccaacttattcatcataaaggtgaatttct |
17270010 |
T |
 |
| Q |
200 |
ctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||| |||||||||| |
|
|
| T |
17270011 |
ctagccactatactacttgacc |
17270032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 99 - 219
Target Start/End: Complemental strand, 27463624 - 27463504
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||||| ||||||| ||||| |||||| | |||| ||||||||| | | | ||||||||||||||||||| |||||||| |
|
|
| T |
27463624 |
ccatgagcttagctcatttggtaaggaataatgcacaatatatgcaggagccgggattcgaacccag-ataacccacttattcatctttaaagtgaattt |
27463526 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
||||| ||||||| ||||||| |
|
|
| T |
27463525 |
ctctaaccactagattacttga |
27463504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 102 - 199
Target Start/End: Original strand, 23405200 - 23405299
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt--taaggtgaatttct |
199 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||||| ||||||||||||||||||||||| |||||||||||||||||| ||| ||||||||||||| |
|
|
| T |
23405200 |
tgagcttagctcagttggtagggacattgcataatatatgcaggggtcggggttcgaaccctggacaccccacttattcaccttaaaaaggtgaatttct |
23405299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 20435781 - 20435899
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| ||| |||||| | | |||| || ||||||||||||| |||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20435781 |
tgagcttagctcacttggtaagggatattgcatattttatgcaaggcccggggttcgaacctcggacatcccacttattcatctttaaggtgaatttctc |
20435880 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
|| | |||||||||||||| |
|
|
| T |
20435881 |
ta-tcgctaggctacttgac |
20435899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 134 - 220
Target Start/End: Original strand, 5207126 - 5207211
Alignment:
| Q |
134 |
aatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||| |||||||||||| |||||||||| ||||||||||||||||| ||||||| ||||||||| |||||||||| ||||||||| |
|
|
| T |
5207126 |
aatatatgcaggggtcgga-ttcgaaccccagacaccccacttattcacctttaagatgaatttctttagccactagactacttgac |
5207211 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 99 - 200
Target Start/End: Original strand, 43684276 - 43684377
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||||| | | |||||||| | ||||||||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
43684276 |
ccatgagcttagctcatttggtaagggataatgcatt-tgtatgcaggggctgaggttcgaaccccgaacaccccacttattcacctttaaggtgaattt |
43684374 |
T |
 |
| Q |
198 |
ctc |
200 |
Q |
| |
|
||| |
|
|
| T |
43684375 |
ctc |
43684377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 9796936 - 9796993
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
9796936 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatcttataaggtgaatt |
9796993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 29035015 - 29035092
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| || || ||||||| ||||||||||||||||||||| |
|
|
| T |
29035015 |
tgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacttga |
29035092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 11133115 - 11133193
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||| ||| |||| |
|
|
| T |
11133115 |
tgcaggggtcggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggttacctgac |
11133193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 14285366 - 14285248
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||| |||||| |||| ||||||||||| |||||||| ||| ||||||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
14285366 |
ccatgagcttagctcatttagtaagggataa--cataatatgtgt-ggggtcggagtttgaaccccagacaccccatttattcatcttt-cggtgaattt |
14285271 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||||||||| |
|
|
| T |
14285270 |
ctctagccactaaactacttgac |
14285248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 99 - 209
Target Start/End: Complemental strand, 25553243 - 25553133
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||| ||||||||||| | | ||||||||||| | | | || ||||||||||||||||||| ||||||| |
|
|
| T |
25553243 |
ccatgagcttaattcatttggtaagggataatgcacaatatgtgcagagattggggttcgaactcag-atactccacttattcatctttaagatgaattt |
25553145 |
T |
 |
| Q |
198 |
ctctagccacta |
209 |
Q |
| |
|
||||| |||||| |
|
|
| T |
25553144 |
ctctaaccacta |
25553133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 99 - 219
Target Start/End: Original strand, 32084842 - 32084956
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||||||||| |||||||||||||| | |||||||| ||| || ||||| |||||||||||||||| ||| | |||||| ||||||||||||| |
|
|
| T |
32084842 |
ccatgagcttagctcatttggtaagggacaatgcatattatatgtaggggccggggttcgaaccccgaacatctcactta-------ttaaggtgaattt |
32084934 |
T |
 |
| Q |
198 |
ctctagccactaggctacttga |
219 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
32084935 |
ttctagccactaggctacttga |
32084956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 153 - 220
Target Start/End: Complemental strand, 37592265 - 37592198
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| ||||||||||||||| | ||||||||||||||||||||||| |||| ||||||||| |
|
|
| T |
37592265 |
gttcgaaccccagacaccccacttatttacctttaaggtgaatttctctagccgctagactacttgac |
37592198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 33228999 - 33228925
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
33228999 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
33228925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 102 - 202
Target Start/End: Original strand, 20375593 - 20375694
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| ||| ||| || | | ||||||| ||||||||||||| | ||||| |||||||||||||||||||||||||||||| |
|
|
| T |
20375593 |
tgagcttagctcacttggtaagggatattgcctattttatgcagggtccggggttcgaacctcagacacgccacttattcatctttaaggtgaatttctc |
20375692 |
T |
 |
| Q |
201 |
ta |
202 |
Q |
| |
|
|| |
|
|
| T |
20375693 |
ta |
20375694 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 580839 - 580760
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||| ||||| ||||||||||||||||| ||||| |
|
|
| T |
580839 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataagatgaat---tctagccactaggctacctgacc |
580760 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 17154688 - 17154767
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||| | ||||||||||||||||| ||||| |
|
|
| T |
17154688 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgagt---tctagccactaggctacctgacc |
17154767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 36755622 - 36755742
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| ||||||||| |||||| || |||| | ||||||||||||| ||||||||||||||| ||| |||| ||||||||||| |||||| |
|
|
| T |
36755622 |
tgagcttaactcacttggtaagggataatggattatatatataggggtcggggtttgaaccccggacacccaactatttcacctttaaggtgactttctc |
36755721 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
| | ||||||||||||||| |
|
|
| T |
36755722 |
cggtcgctaggctacttgacc |
36755742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 8234845 - 8234775
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
8234845 |
aggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctagccactaggctac |
8234775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 20122528 - 20122458
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||| ||||||||||||||||||||| ||||||||||||||| |||||||||| ||||||||||||||||| |
|
|
| T |
20122528 |
aggggccggggttcgaaccccggacacgccacttattcatcttataaggtgaat---tctagccactaggctac |
20122458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 29664642 - 29664720
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||| || ||||||||||||||||||||||||| |||||||||| |||||||||||| |||| |||| |
|
|
| T |
29664642 |
tgcaggggtcggggttcaaatcccggacaccccacttattcatcttataaggtgaat---tctagccactagactacctgac |
29664720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 32891320 - 32891398
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||| |||| ||||| ||||||||||||||||| |||| |
|
|
| T |
32891320 |
tgcaggggtcggttttcgaaccccggacaccccacttattcatcttataagatgaat---tctagccactaggctacctgac |
32891398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 151 - 202
Target Start/End: Complemental strand, 37886270 - 37886219
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||||||| |||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
37886270 |
gggttcgaaccctggacaccccacttattcacctttaaggtgaatttctcta |
37886219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 3037678 - 3037605
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| ||| |||||||||| ||||| ||||||||||| |
|
|
| T |
3037678 |
tgcaggggccggggttcgaaccccggacaccccacttattcaccttataaggtgaat---tctaggcactaggctac |
3037605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 142 - 221
Target Start/End: Complemental strand, 19905709 - 19905632
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||| ||| |||||||||| |||||||| |||||||| ||||| |
|
|
| T |
19905709 |
caggggtcggggttcgaaccccggacacccgacttattcaccttataaggtgaat---tctagccattaggctacctgacc |
19905632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 22653710 - 22653636
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
22653710 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
22653636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 135 - 213
Target Start/End: Complemental strand, 39462999 - 39462921
Alignment:
| Q |
135 |
atatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggct |
213 |
Q |
| |
|
||||||| |||||| || ||||||||| | ||||||||||||||||||||||| ||| |||| ||||||||||||||| |
|
|
| T |
39462999 |
atatgtgtaggggttggagttcgaacctcatacaccccacttattcatctttaaagtggatttttctagccactaggct |
39462921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 40535515 - 40535441
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |||||| |
|
|
| T |
40535515 |
tgagcttagctcagttggtacggatattgcatattatatgcaggggccggggttcgaaccccggacactccactt |
40535441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 17239940 - 17239997
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||||||| ||||||||||| |
|
|
| T |
17239940 |
tgcaggggtcgggattcgaacctcggacaccccacttattcatcttataaggtgaatt |
17239997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 104 - 176
Target Start/End: Original strand, 1844823 - 1844895
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
1844823 |
agcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaacctcggacaccccactt |
1844895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 5206999 - 5207118
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||| |||||||||| ||| |||||||||| | |||||||| ||||||||||||||||| | ||||| ||||||| || |
|
|
| T |
5206999 |
tgagcttaactcatttggtaatagataatgcattttatatgcaggggtcatg-ttcgaacctcggacaccccacttatttacttttaaaatgaatttttc |
5207097 |
T |
 |
| Q |
201 |
tagccactaggctacttgacc |
221 |
Q |
| |
|
||| | ||||||||||||||| |
|
|
| T |
5207098 |
tagtcgctaggctacttgacc |
5207118 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 165 - 221
Target Start/End: Complemental strand, 41541571 - 41541515
Alignment:
| Q |
165 |
gacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||| ||| ||||||||||||||| |
|
|
| T |
41541571 |
gacaccccacttattcacttttaaggtgaatttctctggccgctaggctacttgacc |
41541515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 2304332 - 2304408
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| | || || ||||||| |||| |||||||||||| ||||| |
|
|
| T |
2304332 |
aggggtcggggttcgaaccccggacaccccacttatttactttaaaagtgaatt--tctaaccactaggctacctgacc |
2304408 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 3179363 - 3179441
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||||||| ||| |||||||||| ||||||||||||||||| |||| |
|
|
| T |
3179363 |
tgcaggggtcgaggttcgaacctcagacaccccacttattcaccttataaggtgaat---tctagccactaggctacctgac |
3179441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 3596281 - 3596328
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3596281 |
tgcataatttatgcaggggtcggggttcgaaccccggacaccccactt |
3596328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 4183171 - 4183254
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||||||| |||| |||||| ||||| |||||| ||| |||||| |||||||||||||||||| |||| |||||| |
|
|
| T |
4183171 |
caatccccgtgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccgaacactccactt |
4183254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 143 - 215
Target Start/End: Original strand, 11837031 - 11837101
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||| ||| ||| |||||| ||||||||||||||||| |
|
|
| T |
11837031 |
aggggtcggggttcgaaccccggacacctcacttattcaccttataaagtgaat---tctagccactaggctac |
11837101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 34613983 - 34614050
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
34613983 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacac |
34614050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 99 - 220
Target Start/End: Original strand, 43870950 - 43871070
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||||| || ||| |||| ||||| ||||||| || || |||||| | ||||||||||| ||||||||||||||||||||| || || ||||||| |
|
|
| T |
43870950 |
ccatgagcatagctcggttggcaaggacaatgcattattatatgcaggagccggggttcgaatcccggacaccccacttattcactttaaaagtgaatt- |
43871048 |
T |
 |
| Q |
198 |
ctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||| |||| |
|
|
| T |
43871049 |
-tctagccactaggctacctgac |
43871070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 123 - 181
Target Start/End: Original strand, 44187725 - 44187784
Alignment:
| Q |
123 |
ggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||| || || |||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
44187725 |
ggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattca |
44187784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3301815 - 3301889
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||||||| ||||| ||||| ||| | ||||||||||||||||||||||| |||| |||||| |
|
|
| T |
3301815 |
tgagcttagctcatttggtagggatattgcattttatatacaggggtcggggttcgaaccccgaacactccactt |
3301889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3438952 - 3439026
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
3438952 |
tgagcgtagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
3439026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3446734 - 3446808
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | || ||||||||||||||||||||||||| |
|
|
| T |
3446734 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccgaggttcgaaccccggacaccccactt |
3446808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 5612958 - 5613032
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||||| |||||| ||| |||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
5612958 |
tgagcttagctcagttggcagggatattgcatattatatgcaagggccggggttcgaaccccggacaccccactt |
5613032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 11093854 - 11093780
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||||||| ||| ||||| ||||| ||| |||||| ||||||||||||||||||||||| |||||| |
|
|
| T |
11093854 |
tgagcttaactcatttagtagggatatcgcatattatatgcaggagtcggggttcgaaccccggacactccactt |
11093780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 99 - 200
Target Start/End: Complemental strand, 12183833 - 12183731
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
|||||| |||| |||| |||||||||| |||||||| || | ||||||||||||| ||||||| || |||| |||||| || | ||||||||||||||| |
|
|
| T |
12183833 |
ccatgaacttacctcacttggtaaggaataatgcattatgtatgcaggggtcgggattcgaactccagacatcccactattttacctttaaggtgaattt |
12183734 |
T |
 |
| Q |
198 |
ctc |
200 |
Q |
| |
|
||| |
|
|
| T |
12183733 |
ctc |
12183731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 17034739 - 17034813
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
17034739 |
tgagcttagctcaattggtagggatattgcatattatatgcaggagtcggggttcgaatcccggacactccactt |
17034813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 122 - 176
Target Start/End: Complemental strand, 17777209 - 17777155
Alignment:
| Q |
122 |
aggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| || ||| ||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17777209 |
aggatattgtatattatatgcaggggtcggggttcgaaccccggacaccccactt |
17777155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 20296422 - 20296496
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| ||| |||||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
20296422 |
tgagcttagctcagttgataaggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
20296496 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 20919614 - 20919688
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
20919614 |
tgagcttagctcagttggtagggacattgcataatttatgctggggccggggttcgaaccccggacaccccactt |
20919688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 95 - 181
Target Start/End: Original strand, 22589896 - 22589981
Alignment:
| Q |
95 |
atcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||| | |||||| ||||| |||||| ||| |||| ||||||| ||| |||||||| ||||||||||| |||| |
|
|
| T |
22589896 |
atcaccatgagcttatcttagttggtagggatattgcatattatatgca-gggtcggtgtttgaaccccgaacaccccactttttca |
22589981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 28153208 - 28153134
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| ||||| ||| |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
28153208 |
tgagcttaactcagttggtagggatattgcatgttatatgcaggattcggggttcgaaccccggacaccccactt |
28153134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 143 - 181
Target Start/End: Complemental strand, 36520833 - 36520795
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36520833 |
aggggtcggggttcgaaccccggacaccccacttattca |
36520795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 41509520 - 41509594
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
41509520 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
41509594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 150 - 220
Target Start/End: Original strand, 42998685 - 42998754
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| || ||| ||||| |||| | ||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
42998685 |
ggggttcgaacctcg-acagcccacatatttacctttaaggtgaatttctctagccgctaggctacttgac |
42998754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 140 - 211
Target Start/End: Complemental strand, 44721760 - 44721691
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactagg |
211 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||| ||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
44721760 |
tgcaggggtcggggttcgaacctcggacaccccatttattcaccttataaggtgaat---tctagccactagg |
44721691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 44857300 - 44857226
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
44857300 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccactt |
44857226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 1244608 - 1244649
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
1244608 |
tgcaggggtgggggttcgaaccccggacaccccacttattca |
1244649 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 9547183 - 9547126
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||| |||| |||||||||||||||||||| ||||||||||| |
|
|
| T |
9547183 |
tgcaggggccggggttcgaatcccgaacaccccacttattcatcttataaggtgaatt |
9547126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 102 - 221
Target Start/End: Original strand, 9564538 - 9564659
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgca-ggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| ||| |||||||| ||||||| ||||||| || | ||||| | |||||| |||| ||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
9564538 |
tgagcttagctcgcttggtaagagataatgtataatatatgtaaggggttgtggttcgtaccctggacacctcacttattcacctttaaagtgaatttct |
9564637 |
T |
 |
| Q |
200 |
ctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| | |||||||| ||||| |
|
|
| T |
9564638 |
ctagtcgttaggctacatgacc |
9564659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 9802931 - 9803013
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccac---ttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||| ||||||||||| |||||||||||| |||| |||||||||| ||||| |
|
|
| T |
9802931 |
tgcaagggtcggggttcgaaccccggacaccccacttattattcatcttataaggtgaattt---tagctactaggctacctgacc |
9803013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 10262778 - 10262819
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
10262778 |
tgcaggggtcggggttcgaaccccagacaccccacttattca |
10262819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 185
Target Start/End: Original strand, 25731973 - 25732018
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
25731973 |
tgcaggggtcggagttcgaacctcggacaccccacttattcatctt |
25732018 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 28194633 - 28194710
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| ||| || ||||| |||||| ||| |||||||| || |||||||||||||||||||||||| |
|
|
| T |
28194633 |
ccatgagcttagctcagttgctagggatattgcatattatatgcaggggctggagttcgaaccccggacaccccactt |
28194710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 150 - 219
Target Start/End: Original strand, 31848320 - 31848389
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
||||||| ||||||| ||||| || ||||||| ||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
31848320 |
ggggttcaaaccccgaacacctcaattattcaccttaaaggtgaatttctttaaccactaggctacttga |
31848389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 36665469 - 36665526
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| || ||||||||||| |
|
|
| T |
36665469 |
tgcaggggccggggttcgaacctcggacaccccacttattcattttataaggtgaatt |
36665526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 175 - 220
Target Start/End: Original strand, 38413030 - 38413074
Alignment:
| Q |
175 |
ttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
38413030 |
ttattcatctttaaggtgaatttctcta-ccactaggctacttgac |
38413074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 41699141 - 41699182
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
41699141 |
tgcaggggtcggggttcgaaccccgaacaccccacttattca |
41699182 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 123 - 214
Target Start/End: Complemental strand, 3548868 - 3548780
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||| ||||||||||| ||||| | ||||||||||||||||||| | |||| |||||| |||||||||||||||||| | || |||||||| |
|
|
| T |
3548868 |
ggatgatgcataatatatgcagag-tcggggttcgaaccccggatatccca--tattcaactttaaggtgaatttctcaaaccgctaggcta |
3548780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 127 - 175
Target Start/End: Original strand, 5947895 - 5947943
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
||||||| ||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
5947895 |
aatgcattttatatgcaggggtcggggttcgaaccccggacaccccact |
5947943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 165 - 209
Target Start/End: Original strand, 6270495 - 6270539
Alignment:
| Q |
165 |
gacaccccacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
|||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
6270495 |
gacacctcacttatttatctttaaggtgaatttctctagccacta |
6270539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 219
Target Start/End: Complemental strand, 14269937 - 14269857
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| ||| |||||||||||| |||| ||||||||||||||| ||| ||||||| |||||||||||| ||||||| |
|
|
| T |
14269937 |
tgcaggggccggcgttcgaaccccgaacactccacttattcatcttagaagatgaatttttctagccactagattacttga |
14269857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 153 - 217
Target Start/End: Complemental strand, 17376497 - 17376433
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctactt |
217 |
Q |
| |
|
|||||||||||| |||||| | ||||| || ||||||||||||||||||| || ||||||||||| |
|
|
| T |
17376497 |
gttcgaaccccgaacaccctatttatttatttttaaggtgaatttctctaaccgctaggctactt |
17376433 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 20120781 - 20120713
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || ||||||||| || |||||||||| |
|
|
| T |
20120781 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggttcggggttcaaatcccggacacc |
20120713 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 219
Target Start/End: Original strand, 23403345 - 23403422
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||| | |||||||||||||||| ||||||||||||| ||| |||||||||| | |||||| |||||||||||| |
|
|
| T |
23403345 |
tgcaggggcccgggttcgaaccccggattccccacttattcaccttaaaggtgaatt--tatagccattaggctacttga |
23403422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 34018126 - 34018047
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||||||||||| ||| |||||||||| |||| |||||||||||| ||||| |
|
|
| T |
34018126 |
tgcaggggctggggttcgaacctcggacaccccacttattcaccttataaggtgaat---tctaaccactaggctacctgacc |
34018047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 149 - 220
Target Start/End: Original strand, 34034398 - 34034467
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||| || || ||||||| |||||||||||| |||| |||| |
|
|
| T |
34034398 |
cggggttcgaaccccggacaccccacttattcactttaaaagtgaatt--tctagccactagactacctgac |
34034467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 154 - 202
Target Start/End: Complemental strand, 35710213 - 35710165
Alignment:
| Q |
154 |
ttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
35710213 |
ttcgaaccccaaacatcccacttattcatctttaaggtgaatttctcta |
35710165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 92 - 176
Target Start/End: Complemental strand, 38525629 - 38525545
Alignment:
| Q |
92 |
tcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| || |||||||| |||| |||||||||||| ||||| ||| |||||||||| |||||||||||| | |||| |||||| |
|
|
| T |
38525629 |
tcaatccccgtgagcttagctcagttggtaaggatattgcattttatatgcaggggtcagggttcgaacccggaacactccactt |
38525545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 102 - 178
Target Start/End: Complemental strand, 38557289 - 38557213
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||| ||| |||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
38557289 |
tgagcttaactcagttggtagggatatggcattttatatgcaggggtcggggttcgaaccccggacacttcacttat |
38557213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 7379666 - 7379595
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| |||| |||||||||||| |||||| ||| ||||| |||||||||||||| ||| |||||||| |
|
|
| T |
7379666 |
tgagcttaactcagttggtaaggatattgcatattatatgcagaggtcggggttcgaattccgaacacccca |
7379595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 8250367 - 8250300
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||||||||||||||| ||||| |
|
|
| T |
8250367 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccagacac |
8250300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 22538578 - 22538656
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||| |||||||||| |||| ||||| |||||||||| ||| ||||||||||| |||||||||||||||| |||| |
|
|
| T |
22538578 |
tgcaggggttggggttcgaatcccgaacacctcacttattcaccttataaggtgaatt---ctagccactaggctacctgac |
22538656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 173
Target Start/End: Complemental strand, 23919543 - 23919472
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||||| || ||||||||||||||||| ||| ||||||||| |
|
|
| T |
23919543 |
tgagcttagctcagttggtagggacattgcataatatatggaggggtcggggttcgaatcccagacacccca |
23919472 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 181
Target Start/End: Complemental strand, 30392898 - 30392819
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||| ||||||||||||||||| ||||| |||||| |||| |
|
|
| T |
30392898 |
tgagcttagctcagttggtagggatattgcatattatatgtaggagtcggggttcgaaccccagacactccacttgttca |
30392819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 220
Target Start/End: Original strand, 31605499 - 31605617
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||| || |||||| |||||||||| ||| ||||||| ||||||||||||| | ||||| | ||||||| |||||| |||||||||| |
|
|
| T |
31605499 |
tgagcttaactcacttagtaagggataatgcata-tatatgcagggaacggggttcgaacctcagacactttatttattcacatttaagatgaatttctc |
31605597 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
|| ||||||| ||||||||| |
|
|
| T |
31605598 |
tacccactagactacttgac |
31605617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 123 - 209
Target Start/End: Original strand, 34235805 - 34235891
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc-cacttattcatctttaaggtgaatttctctagccacta |
209 |
Q |
| |
|
||||||||||||| ||||||| |||||| |||||||| || |||||| ||||||||||| |||||| ||||||||||||| ||||| |
|
|
| T |
34235805 |
ggataatgcataaaatgtgcaagggtcgaagttcgaactccaaacaccctcacttattcat-tttaagatgaatttctctagtcacta |
34235891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 99 - 178
Target Start/End: Original strand, 35367412 - 35367491
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
||||||||||| |||| ||| ||| |||| |||||| ||| | || ||| || ||||||||||||||||||||||||||| |
|
|
| T |
35367412 |
ccatgagcttagctcagttgataatgatattgcatattatatacaagggccgaggttcgaaccccggacaccccacttat |
35367491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 143 - 215
Target Start/End: Complemental strand, 36426909 - 36426839
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||| ||||||||||| ||| |||||||||||||||||||| |||||||||| ||||||||||| ||||| |
|
|
| T |
36426909 |
aggggttggggttcgaactccgaacaccccacttattcatcttataaggtgaat---tctagccactatgctac |
36426839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 40363137 - 40363070
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| || ||||||||||||||||||||| ||||| |
|
|
| T |
40363137 |
tgagcttaactcagttggtagggatattgcatattatatgtaggggtcggggttcgaacccccgacac |
40363070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 1071474 - 1071548
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
1071474 |
tgagcttagctcagttggtatggatattgtatattatatgcaggagccggggttcgaaccccggacactccactt |
1071548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 196
Target Start/End: Complemental strand, 2114488 - 2114434
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||||||| || ||||||| ||| ||||||||||| |
|
|
| T |
2114488 |
aggggtcggggttcgaaccccggacacctcatttattcaccttataaggtgaatt |
2114434 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 2643701 - 2643775
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
2643701 |
tgagcatagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
2643775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 3287122 - 3287048
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||| | ||||| |||||| ||| |||||||| |||||||||||||||||| || |||||| |
|
|
| T |
3287122 |
tgagcttagctcagttggaagggatattgcatattatatgcaggggccggggttcgaaccccggatactccactt |
3287048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4562818 - 4562744
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
4562818 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
4562744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 180
Target Start/End: Original strand, 10058872 - 10058950
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattc |
180 |
Q |
| |
|
|||||||| |||| |||||| || |||||||||||| |||| |||||||||| |||||||||||| | ||||||||| |
|
|
| T |
10058872 |
tgagcttaactcaattggtagagacaatgcataatatatgcaaaggtcggggtttgaaccccggacaactcacttattc |
10058950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 11050823 - 11050749
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| | |||| ||| |||||||| ||||||||||| ||||||||||||||| |
|
|
| T |
11050823 |
tgagcttagctcagttggtagggatattacatattatatgcaggggctggggttcgaactccggacaccccactt |
11050749 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 182
Target Start/End: Complemental strand, 15069827 - 15069785
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||| |||||| ||||| |
|
|
| T |
15069827 |
tgcaggggtcggggttcgaaccccggacactccacttcttcat |
15069785 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 19281612 - 19281686
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
19281612 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactt |
19281686 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 32609253 - 32609179
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||| | |||||||||||||| |||||||| |||||| |
|
|
| T |
32609253 |
tgagcttaactcagttggtagggatattgcatattatatgcaagagtcggggttcgaactccggacactccactt |
32609179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 197
Target Start/End: Original strand, 32891638 - 32891696
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaattt |
197 |
Q |
| |
|
||||||||| ||||||||||||| | |||||||||||||||||||| ||||||||||| |
|
|
| T |
32891638 |
tgcaggggttggggttcgaaccctgaacaccccacttattcatcttacaaggtgaattt |
32891696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 33001609 - 33001536
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||| ||| ||||||| ||| ||||||||||||||||||||||||| |||||||||| |||||| |||||||||| |
|
|
| T |
33001609 |
tgcaagggccggggtttgaatcccggacaccccacttattcatcttataaggtgaat---tctagctactaggctac |
33001536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 36182646 - 36182720
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
36182646 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagcaggggttcgaaccccggacactccactt |
36182720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 181
Target Start/End: Original strand, 37912471 - 37912509
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
37912471 |
aggggtcggggttcaaaccccggacaccccacttattca |
37912509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 148 - 214
Target Start/End: Original strand, 1836635 - 1836699
Alignment:
| Q |
148 |
tcggggttcgaaccccggacaccccacttattcatc-tttaaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||| | | |||||||||| |||||||||||||||| |
|
|
| T |
1836635 |
tcggggttcgaaccccggacaccctacttattcaccatataaggtgaat---tctagccactaggcta |
1836699 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 142 - 220
Target Start/End: Original strand, 12206539 - 12206617
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcatctt---taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||| ||||||| |||||||| ||| ||||||||| ||||||||||||||||| |||| |
|
|
| T |
12206539 |
caggggtcggggttcgaaccccgaacaccccgcttattcaccttgaaaaaggtgaat---tctagccactaggctacctgac |
12206617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 14307750 - 14307709
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
14307750 |
tgcaggggtcgaggttcgaaccccgaacaccccacttattca |
14307709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 99 - 147
Target Start/End: Original strand, 16403522 - 16403571
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaa-ggataatgcataatatgtgcagggg |
147 |
Q |
| |
|
||||||||||| |||||||||||| |||||||||| |||||||||||||| |
|
|
| T |
16403522 |
ccatgagcttagctcatttggtaagggataatgcacaatatgtgcagggg |
16403571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 150 - 220
Target Start/End: Complemental strand, 18386858 - 18386790
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||| |||||||||||||||||||| ||| |||| ||||| ||||||| |||||||||||||| |
|
|
| T |
18386858 |
ggggttcgaactccggacaccccacttattcaccttataagatgaat---tctagccgctaggctacttgac |
18386790 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 19052667 - 19052622
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||||||| || ||||||||||||||| |||||||||||||||| |
|
|
| T |
19052667 |
tgcaggggtcaggattcgaaccccggacatcccacttattcatctt |
19052622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 220
Target Start/End: Complemental strand, 22437307 - 22437196
Alignment:
| Q |
102 |
tgagcttatctcatttggtaag-gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||| ||||||||||| ||| || |||| | ||||||||||| ||||||||| |||||||| ||||||||||||| |
|
|
| T |
22437307 |
tgagcttaagtcatttggtaagtgataatgcatattatatgtagggtt-ggggttcgaactccggacaccttacttattc-------aggtgaatttctc |
22437216 |
T |
 |
| Q |
201 |
tagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||| |||||||| |
|
|
| T |
22437215 |
tagccaataggttacttgac |
22437196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 24034109 - 24034068
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||| ||||||| ||||||||||| |
|
|
| T |
24034109 |
tgcaggggtcggggttcgaacctcggacactccacttattca |
24034068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 30390426 - 30390361
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||||| |||| |
|
|
| T |
30390426 |
ctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacaccctactt |
30390361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 30474251 - 30474194
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| || |||||||||||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
30474251 |
tgcaggggccgaggttcgaaccccagacaccccacttattcaccttataaggtgaatt |
30474194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 103 - 176
Target Start/End: Complemental strand, 32190067 - 32189994
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||| ||| | |||||||| | |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
32190067 |
gagcttagttcagttggtagggacattgcataatttatgcaggggccggggttcgaaccccggacacctcactt |
32189994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 36101688 - 36101737
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| ||| |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
36101688 |
aatgcatattatatgcaggggctggggttcgaaccccggacaccccactt |
36101737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 44422146 - 44422187
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||||||||| |
|
|
| T |
44422146 |
tgcagggatcggagttcgaaccccggacaccccacttattca |
44422187 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 168
Target Start/End: Complemental strand, 44666388 - 44666343
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggaca |
168 |
Q |
| |
|
||||| |||||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
44666388 |
ggatattgcataatatatgcagggatcggggttcgaaccccggaca |
44666343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 3402723 - 3402683
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
3402723 |
cacttattcatctttaaggtgaatttttccagccactaggc |
3402683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 184 - 220
Target Start/End: Complemental strand, 4632081 - 4632045
Alignment:
| Q |
184 |
tttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
4632081 |
tttaaggtgaatttctctagccactaggctatttgac |
4632045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 100 - 164
Target Start/End: Complemental strand, 5168641 - 5168577
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||||| |||| ||| || |||||||||||||||| |||| || ||||||||| ||||||| |
|
|
| T |
5168641 |
catgagcttaactcagttgatagggataatgcataatatatgcaaggttcggggttcaaaccccg |
5168577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 116 - 220
Target Start/End: Original strand, 12832564 - 12832668
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaa--ggtgaatttctctagccactaggct |
213 |
Q |
| |
|
|||||| ||||| |||||||||| || ||||||||| |||||||| | | ||||||||||||||| |||| ||||||||||| | |||||||||| |
|
|
| T |
12832564 |
ttggtagggatattgcataatatctgaaggggtcggagttcgaacatcaaaaaccccacttattcatagttaaaaggtgaatttct--aaccactaggct |
12832661 |
T |
 |
| Q |
214 |
acttgac |
220 |
Q |
| |
|
||||||| |
|
|
| T |
12832662 |
acttgac |
12832668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 124 - 176
Target Start/End: Complemental strand, 13242775 - 13242723
Alignment:
| Q |
124 |
gataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||||| | |||||||||||||||||||||| |||||||| ||||| |
|
|
| T |
13242775 |
gatattgcataatttatgcaggggtcggggttcgaacctcggacacctcactt |
13242723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 181
Target Start/End: Original strand, 18254592 - 18254672
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||| |||||| |||||| ||||| ||| |||||||| |||||||||||| || |||||||||||| |||| |
|
|
| T |
18254592 |
tgagcttaactcagttggtagggataaatgcattttatatgcaggggccggggttcgaactccagacaccccacttcttca |
18254672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 162
Target Start/End: Original strand, 24593377 - 24593437
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || |||||||||||||| |
|
|
| T |
24593377 |
tgagcttagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaaccc |
24593437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 145 - 181
Target Start/End: Complemental strand, 25406701 - 25406665
Alignment:
| Q |
145 |
gggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||| |
|
|
| T |
25406701 |
gggtcggggttcgaactccggacaccccacttattca |
25406665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 27152354 - 27152422
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| |||||||||||||||| |||| || ||||||||||||| ||||||| |
|
|
| T |
27152354 |
tgagcttaactcagttggtagggataatgcataatatatgcaaggtctggggttcgaacccaggacacc |
27152422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 141 - 181
Target Start/End: Original strand, 32256176 - 32256216
Alignment:
| Q |
141 |
gcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
32256176 |
gcaggggtcggggttcgaactccggacatcccacttattca |
32256216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 142 - 182
Target Start/End: Complemental strand, 33116261 - 33116221
Alignment:
| Q |
142 |
caggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||||| ||||||||||||||||||||||| |||||||||| |
|
|
| T |
33116261 |
caggggccggggttcgaaccccggacaccctacttattcat |
33116221 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 1964384 - 1964431
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | |||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
1964384 |
tgcataatttatgcaggggccggggttcaaaccccggacaccccactt |
1964431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #153
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 2289614 - 2289681
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| | ||| |||||| ||| |||||||||| |||||||||||| |||||| |
|
|
| T |
2289614 |
tgagcttagctcagttggtaggaatattgcatattatatgcaggggtcagggttcgaaccctggacac |
2289681 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #154
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 89 - 176
Target Start/End: Complemental strand, 5521299 - 5521212
Alignment:
| Q |
89 |
aaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| ||| || |||||||| |||| ||| || ||||| |||||| ||| |||||||| || ||||||||||| |||||| |||||| |
|
|
| T |
5521299 |
aaatctatccccgtgagcttagctcagttgatagggatattgcatattatatgcaggggccgaggttcgaaccctggacactccactt |
5521212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #155
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Complemental strand, 6636033 - 6635966
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||| |||||||||||||||||||| |
|
|
| T |
6636033 |
tgagcttagctcagttggtagggatattgcatattatatgcagggacgggggttcgaaccccggacac |
6635966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #156
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 101 - 176
Target Start/End: Original strand, 8322809 - 8322884
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||| ||| |||||| || || |||||| ||| | ||||||||||||||||||||| ||||| ||||||| |
|
|
| T |
8322809 |
atgagcttagttcagttggtaggggtattgcatattatatacaggggtcggggttcgaaccctggacatcccactt |
8322884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #157
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 17078461 - 17078528
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| || ||| ||| |||||| ||||||||||||| ||||||||| |
|
|
| T |
17078461 |
tgagcttagctcagttggtagggatattgtatattatatgcaggagtcggggttcgaatcccggacac |
17078528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #158
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 21970495 - 21970436
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||||| ||||||||||||||||||| ||||| |||||||| || || |||||||||| |
|
|
| T |
21970495 |
tgcagggatcggggttcgaaccccggataccccgcttattcactttaaaagtgaatttct |
21970436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #159
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 23984290 - 23984215
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataa-tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| || ||||| ||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
23984290 |
tgagcttagctcaattggtagggacaaatgcattttatatgcaggggccagggttcgaaccccggacaccccactt |
23984215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #160
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 111 - 181
Target Start/End: Complemental strand, 31594452 - 31594381
Alignment:
| Q |
111 |
ctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||| ||||||||||||| || |||||||| ||||||| ||| |||||||| ||||||| |
|
|
| T |
31594452 |
ctcatttggtaaggaataatgcataatatatgtaggggtcgaagttcgaatcccaaacaccccatttattca |
31594381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #161
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 199
Target Start/End: Complemental strand, 32527133 - 32527074
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||| ||||||||||||||| |||| |||||||||||| || || |||||||||| |
|
|
| T |
32527133 |
tgcaggggccggggttcgaaccccagacaacccacttattcactttaaaagtgaatttct |
32527074 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #162
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 157
Target Start/End: Complemental strand, 33233288 - 33233233
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcg |
157 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||| ||| |||||| ||||||||||| |
|
|
| T |
33233288 |
tgagcttatctcagttggtagggatattgcatattatatgcaggagtcggggttcg |
33233233 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #163
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Original strand, 44558033 - 44558080
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| | |||||||| ||||||||||||||||||||||||||| |
|
|
| T |
44558033 |
tgcataatttatgcaggggctggggttcgaaccccggacaccccactt |
44558080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #164
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 44948600 - 44948667
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| ||||||| |||||||||||||| |||||| |
|
|
| T |
44948600 |
tgagcttagctcagttggtagggatattgcatattatatgcagggaccggggttcgaaccctggacac |
44948667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #165
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 164
Target Start/End: Original strand, 5676740 - 5676802
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||| |||| ||||||| || |||||||||||| |||| |||| ||||||| ||||||| |
|
|
| T |
5676740 |
tgagcttaactcagttggtaatgacaatgcataatatatgcaagggtgggggttcaaaccccg |
5676802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #166
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 10602044 - 10602086
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccc-cggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
10602044 |
tgcaggggacggggttcgaacccacggacaccccacttattca |
10602086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #167
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 18278483 - 18278409
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| ||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||||||||| |||||| |
|
|
| T |
18278483 |
tgagtttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaatcccggacactccactt |
18278409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #168
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 129 - 199
Target Start/End: Complemental strand, 21021767 - 21021697
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
||||| |||| |||||||||||| ||||||||| | |||||||||||||| ||||| || ||||| |||| |
|
|
| T |
21021767 |
tgcattatatatgcaggggtcggagttcgaacctggaacaccccacttatttatcttaaaagtgaacttct |
21021697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #169
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 25857361 - 25857287
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| |||||||| |||||| |
|
|
| T |
25857361 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaacaccggacactccactt |
25857287 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #170
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 143 - 181
Target Start/End: Original strand, 32288418 - 32288456
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||| |||||||||||||| ||||||||||||||||||| |
|
|
| T |
32288418 |
agggatcggggttcgaacctcggacaccccacttattca |
32288456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #171
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 111 - 173
Target Start/End: Complemental strand, 33816473 - 33816411
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacccca |
173 |
Q |
| |
|
|||| |||||| |||| |||||| ||| ||||||||||||| ||||||||||| |||||||| |
|
|
| T |
33816473 |
ctcagttggtagagatattgcatattatatgcaggggtcgggtttcgaaccccgaacacccca |
33816411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #172
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 36005446 - 36005520
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||| ||||| |||||| |
|
|
| T |
36005446 |
tgagcgtaactcaattggtagggatattgcatattatatgcaggagccggggttcgaaccccagacactccactt |
36005520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #173
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 39408756 - 39408682
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||| | | ||||||||||||||| ||||| |||||| |
|
|
| T |
39408756 |
tgagcttaactcagttggtagggatattgcatattatatgcaagagccggggttcgaaccccagacactccactt |
39408682 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #174
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 185
Target Start/End: Complemental strand, 279854 - 279809
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
|||||| | ||||||| |||||||||||| |||||||||||||||| |
|
|
| T |
279854 |
tgcaggagccggggtttgaaccccggacatcccacttattcatctt |
279809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #175
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 1500974 - 1501039
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| |||||| |
|
|
| T |
1500974 |
ctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccactt |
1501039 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #176
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 4529819 - 4529778
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||| |
|
|
| T |
4529819 |
tgcaggggtcggagttcgaactccgaacaccccacttattca |
4529778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #177
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 7086292 - 7086349
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| |||| ||||||||||| |||||||| ||||||| ||| ||||||||||| |
|
|
| T |
7086292 |
tgcaggggccgggattcgaaccccgaacaccccaattattcaccttataaggtgaatt |
7086349 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #178
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 16385111 - 16385034
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| |||||| ||||| ||||| ||| ||||| | |||||||||||| |||||||| |||||| |
|
|
| T |
16385111 |
ccatgagcttagctcagttggtatggatattgcattttatatgcagagaccggggttcgaactccggacactccactt |
16385034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #179
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 16973947 - 16974004
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||| || |||||||||||||||||||||||||| | ||| ||||||||||| |
|
|
| T |
16973947 |
tgcaggggttaggattcgaaccccggacaccccacttatttaccttataaggtgaatt |
16974004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #180
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 22297508 - 22297467
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
22297508 |
tgcaggggcaggggttcgaaccccggacaccccatttattca |
22297467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #181
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 28692530 - 28692477
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| ||||| ||| ||||||||||||||||||||||| |||||| |||||| |
|
|
| T |
28692530 |
ggatattgcattttatatgcaggggtcggggttcgaacccaggacactccactt |
28692477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #182
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 99 - 176
Target Start/End: Original strand, 31223621 - 31223698
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| ||| |||||| ||||| |||||| ||| |||||||| |||||| ||||||| ||||| |||||| |
|
|
| T |
31223621 |
ccatgagcttagttcagttggtagggatattgcatattatatgcaggggctggggtttgaaccccagacactccactt |
31223698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #183
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 127 - 176
Target Start/End: Original strand, 32220996 - 32221045
Alignment:
| Q |
127 |
aatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||| ||| |||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
32220996 |
aatgcattttatatgcaggggccggggttcgaacctcggacaccccactt |
32221045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #184
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 111 - 176
Target Start/End: Original strand, 34355734 - 34355799
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| || ||| ||| |||||||| ||||||||||||||| ||||| |||||| |
|
|
| T |
34355734 |
ctcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccagacactccactt |
34355799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #185
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 36413799 - 36413840
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
36413799 |
tgcaggggccggagttcgaaccctggacaccccacttattca |
36413840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #186
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 38400314 - 38400392
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcgg----ggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| ||| ||||||||||| ||||||||||||| |
|
|
| T |
38400314 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggccggggttcgaaccctggacaccccactt |
38400392 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #187
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 43200879 - 43200920
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
43200879 |
tgcaggggccggagttcgaaccccgaacaccccacttattca |
43200920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #188
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 45523704 - 45523761
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||| |||||| ||| ||||||||||| |
|
|
| T |
45523704 |
tgcaggggtcggggttcgaaccccaaacacctcacctattcaccttataaggtgaatt |
45523761 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #189
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 2256972 - 2257040
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || |||||||||||||||| |||| |
|
|
| T |
2256972 |
tgagcttaactcagttggtatggacaatgcataatatatgcaaggtctggggttcgaaccccggccacc |
2257040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #190
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 153 - 181
Target Start/End: Complemental strand, 4157692 - 4157664
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
4157692 |
gttcgaaccccggacaccccacttattca |
4157664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #191
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 103 - 143
Target Start/End: Complemental strand, 7772519 - 7772479
Alignment:
| Q |
103 |
gagcttatctcatttggtaaggataatgcataatatgtgca |
143 |
Q |
| |
|
||||||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
7772519 |
gagcttaactcaattggtaaggataatgcataatatatgca |
7772479 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #192
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 100 - 164
Target Start/End: Original strand, 11560497 - 11560561
Alignment:
| Q |
100 |
catgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||||||| |||| |||||| ||| |||||||||||| |||| || || |||||| ||||||| |
|
|
| T |
11560497 |
catgagcttagctcaattggtagggacaatgcataatatatgcaaggttcagggttcaaaccccg |
11560561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #193
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 11950024 - 11949988
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| || ||||||||||||||||||||||||| |
|
|
| T |
11950024 |
tgcaggggacgaggttcgaaccccggacaccccactt |
11949988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #194
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 162
Target Start/End: Complemental strand, 15654929 - 15654869
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccc |
162 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||| || |||| || ||||||||||||| |
|
|
| T |
15654929 |
tgagcttagctcagttggtaaggataatgcataaaatatgcaaggtctggggttcgaaccc |
15654869 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #195
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 116 - 176
Target Start/End: Original strand, 17089261 - 17089321
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| | ||| |||||| ||| |||||| ||||||||||||| ||||||||| |||||| |
|
|
| T |
17089261 |
ttggtaggaatattgcatattatatgcaggagtcggggttcgaatcccggacactccactt |
17089321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #196
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 18910593 - 18910525
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
||||||||||||| |||||||||| || ||||||||| |||| || |||||||||||| ||||||| |
|
|
| T |
18910593 |
tgagcttatctcagttggtaaggacaacgcataatatatgcaaggcctagggttcgaaccctggacacc |
18910525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #197
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 20455892 - 20455960
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || ||||||||||| ||||| |||| |
|
|
| T |
20455892 |
tgagcttagctcaattggtatggacaatgcataatatatgcaaggtccggggttcgaatcccggccacc |
20455960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #198
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 24393246 - 24393314
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||| |||||| |||||||||||| |||| || | ||||||||||||||||||| |
|
|
| T |
24393246 |
tgagcttagctcagttgttaaggacaatgcataatatatgcaaggtctgaggttcgaaccccggacacc |
24393314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #199
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 24548012 - 24548080
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| ||| |||||||| | || || |||||||||||||| ||||||| |
|
|
| T |
24548012 |
tgagcttagctcagttggtaaggacaatccataatatattcaaggtccggggttcgaaccctggacacc |
24548080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #200
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 28771583 - 28771651
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||| ||| |||| |||||||||| |||||||||||| |||| | || ||||||||||||||||||| |
|
|
| T |
28771583 |
tgagtttagctcagttggtaaggacaatgcataatatatgcaagatccgcggttcgaaccccggacacc |
28771651 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 29544628 - 29544696
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||| ||| |||||||||||| |||| || |||||||| |||||||| |||| |
|
|
| T |
29544628 |
tgagcttagctcaattggtagggacaatgcataatatatgcaaggtccggggttcaaaccccggccacc |
29544696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 150 - 215
Target Start/End: Original strand, 31564138 - 31564201
Alignment:
| Q |
150 |
ggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||||||||||| |||||||||||||| ||| |||| ||||| |||||||||||| |||| |
|
|
| T |
31564138 |
ggggttcgaaccccggaaaccccacttattcaccttataagatgaat---tctagccactagactac |
31564201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 140 - 176
Target Start/End: Original strand, 33262484 - 33262520
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||||||||||||||||| ||||||| |||||| |
|
|
| T |
33262484 |
tgcaggggtcggggttcgaacctcggacactccactt |
33262520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 149 - 185
Target Start/End: Complemental strand, 35694827 - 35694791
Alignment:
| Q |
149 |
cggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||| ||||||||| ||||||||||| |
|
|
| T |
35694827 |
cggggttcgaaccccagacaccccatttattcatctt |
35694791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Complemental strand, 37320577 - 37320509
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| ||||||| || |||||||||||| |||| || ||| |||||||||| ||||||| |
|
|
| T |
37320577 |
tgagcttaactcagttggtaaagacaatgcataatatatgcaaggttcgaggttcgaaccatggacacc |
37320509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 99 - 143
Target Start/End: Complemental strand, 40099446 - 40099402
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgca |
143 |
Q |
| |
|
||||||||||| |||| |||||||||| |||||||||||| |||| |
|
|
| T |
40099446 |
ccatgagcttagctcagttggtaaggacaatgcataatatatgca |
40099402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 148 - 176
Target Start/End: Original strand, 44021123 - 44021151
Alignment:
| Q |
148 |
tcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
44021123 |
tcggggttcgaaccccggacaccccactt |
44021151 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0018 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0018
Description:
Target: scaffold0018; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 99 - 220
Target Start/End: Complemental strand, 121897 - 121770
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccc------cggacaccccacttattcatctttaaggt |
191 |
Q |
| |
|
||||||||||| ||||||||||| || |||||||| ||||||||||||| |||||||||||||| |||||||| ||||||||||| |||||||| |
|
|
| T |
121897 |
ccatgagcttagctcatttggtaggggataatgcacaatatgtgcagggaccggggttcgaaccccgggcacggacacctcacttattcat-tttaaggt |
121799 |
T |
 |
| Q |
192 |
gaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||| |||||||||||||||| ||||| |
|
|
| T |
121798 |
gaatttatctagccactaggctatttgac |
121770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 47; Significance: 6e-18; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 10892 - 10818
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
10892 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggccggggttcgaaccccggacaccccactt |
10818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0072
Description:
Target: scaffold0072; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 125 - 202
Target Start/End: Complemental strand, 17804 - 17727
Alignment:
| Q |
125 |
ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctcta |
202 |
Q |
| |
|
|||||||||||||| ||||||| | || ||||||||| | |||||| ||||||||||| ||||||||||||||||||| |
|
|
| T |
17804 |
ataatgcataatatatgcagggattggagttcgaacctcagacacctcacttattcatttttaaggtgaatttctcta |
17727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0072; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 25696 - 25763
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||||||| | |||||||||||| |||||| || || |||||||||||||||| |
|
|
| T |
25696 |
tgagcttagctcagttggtaagaacaatgcataatatatgcaggtctcaggattcgaaccccggacac |
25763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1112 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold1112
Description:
Target: scaffold1112; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 215
Target Start/End: Complemental strand, 2493 - 2423
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
||||||||||||| |||||| ||||||||||||||||||||||||| |||||||||| ||||||||||||||| |
|
|
| T |
2493 |
tgcaggggtcgggattcgaatcccggacaccccacttattcatctt--aggtgaattt---tagccactaggctac |
2423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Complemental strand, 4861 - 4783
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
|||||||| ||||||||||| ||||||||||||||||||||| || || ||||||| ||||||||||||||||||||||| |
|
|
| T |
4861 |
tgcagggg-cggggttcgaatcccggacaccccacttattcactttaaaagtgaatt--tctagccactaggctacttgacc |
4783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 42; Significance: 0.000000000000006; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 42; E-Value: 0.000000000000006
Query Start/End: Original strand, 140 - 220
Target Start/End: Original strand, 7115 - 7193
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||| || || ||||||| ||||||||||||||||| |||| |
|
|
| T |
7115 |
tgcaggggccggggttcgaaccccggacaccccatttattcactttaaaagtgaatt--tctagccactaggctacctgac |
7193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0011 (Bit Score: 41; Significance: 0.00000000000002; HSPs: 1)
Name: scaffold0011
Description:
Target: scaffold0011; HSP #1
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 123 - 199
Target Start/End: Complemental strand, 15403 - 15328
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttct |
199 |
Q |
| |
|
|||||||||||| | | |||||||||||||||||||||||| |||| | || | ||||||||||||||||||||||| |
|
|
| T |
15403 |
ggataatgcatatt-tatgcaggggtcggggttcgaaccccagacatcgcagtcattcatctttaaggtgaatttct |
15328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 116 - 178
Target Start/End: Complemental strand, 236407 - 236347
Alignment:
| Q |
116 |
ttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttat |
178 |
Q |
| |
|
|||||| ||||| |||||| |||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
236407 |
ttggtagggatattgcatattatg--caggggtcggggttcgaaccccggacaccccacttat |
236347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0007 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0007
Description:
Target: scaffold0007; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 103 - 221
Target Start/End: Original strand, 146774 - 146892
Alignment:
| Q |
103 |
gagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctct |
201 |
Q |
| |
|
||||||| ||||||| || ||| | |||||| ||||||||||||| | || ||| |||||| ||||||| || | |||||||| ||||||||||||||| |
|
|
| T |
146774 |
gagcttaactcatttagtgagggacaatgcacaatatgtgcagggattggagtttgaaccctagacaccc-acctgttcatcttaaaggtgaatttctct |
146872 |
T |
 |
| Q |
202 |
agccactaggctacttgacc |
221 |
Q |
| |
|
|||| ||| ||||||||||| |
|
|
| T |
146873 |
agccgctacgctacttgacc |
146892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0460 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0460
Description:
Target: scaffold0460; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 105 - 171
Target Start/End: Complemental strand, 13266 - 13200
Alignment:
| Q |
105 |
gcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccc |
171 |
Q |
| |
|
||||| |||| |||||| ||||| |||||| ||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
13266 |
gcttagctcagttggtagggatattgcatattatatgcaggggttggggttcgaaccccggacaccc |
13200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0445 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0445
Description:
Target: scaffold0445; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 4080 - 4006
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| ||||||||||||||||| ||||| |||||| |
|
|
| T |
4080 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagtcggggttcgaaccccagacactccactt |
4006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 926 - 852
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
926 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0157 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0157
Description:
Target: scaffold0157; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 15768 - 15842
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||||| |||||| ||||| |||||| ||| |||||| |||| ||||||||||||||| || |||||| |
|
|
| T |
15768 |
tgagcttatctcagttggtagggatattgcatattatatgcaggagtcgaggttcgaaccccggatactccactt |
15842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 59787 - 59861
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
59787 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
59861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 99 - 176
Target Start/End: Complemental strand, 3031 - 2954
Alignment:
| Q |
99 |
ccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||||||||| |||| ||| | ||| | |||||||| | |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
3031 |
ccatgagcttagctcagttgaaagggacattgcataatttatgcaggggccggggttcgaaccccggacaccccactt |
2954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 140 - 181
Target Start/End: Original strand, 4362 - 4403
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
4362 |
tgcaggggtcggggttcgaaccccggacactccacttattca |
4403 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 105 - 197
Target Start/End: Original strand, 22462 - 22555
Alignment:
| Q |
105 |
gcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaattt |
197 |
Q |
| |
|
||||| |||| ||||||||| ||||| |||| ||| || ||||| | |||||||||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
22462 |
gcttagctcacttggtaagggataatacatattatatgtaggggctgaggttcgaaccccagacatcccacttattcatttttaaggtgaattt |
22555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 38; Significance: 0.000000000002; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 143 - 221
Target Start/End: Original strand, 49862 - 49938
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||| |||||||||||||||| |||||||||||||||| ||| |||||||||| |||||||||||| |||| ||||| |
|
|
| T |
49862 |
aggggccggggttcgaaccccgtacaccccacttattcaacttataaggtgaat---tctagccactagactacctgacc |
49938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0108 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: scaffold0108
Description:
Target: scaffold0108; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 172 - 212
Target Start/End: Complemental strand, 18370 - 18330
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactaggc |
212 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
18370 |
cacttattcatctttaaggtgaatttttctagccactaggc |
18330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1372 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold1372
Description:
Target: scaffold1372; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 105 - 176
Target Start/End: Original strand, 1871 - 1942
Alignment:
| Q |
105 |
gcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||| |||||| ||||| |||||| ||| |||||||| || |||||||||||||||||| |||||| |
|
|
| T |
1871 |
gcttagctcagttggtagggatattgcatattatatgcaggggccgaggttcgaaccccggacactccactt |
1942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0687 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0687
Description:
Target: scaffold0687; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 151 - 215
Target Start/End: Original strand, 1471 - 1533
Alignment:
| Q |
151 |
gggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctac |
215 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| || ||||||| ||||||||||||||||| |
|
|
| T |
1471 |
gggttcaaaccccggacaccccacttattcatcttatagggtgaat---tctagccactaggctac |
1533 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0204 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0204
Description:
Target: scaffold0204; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Original strand, 10576 - 10678
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagg-ataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||| ||||| |||||||| |||| || ||||| ||| |||||||| | |||||| ||||||| ||||||||| ||||||||||| |
|
|
| T |
10576 |
tgagcttagctcatttgataagggataatgcacaataaatgtagggg-cggagttcgaacttcagacacctcacttatccatctttaaagtgaatttctc |
10674 |
T |
 |
| Q |
201 |
tagc |
204 |
Q |
| |
|
|||| |
|
|
| T |
10675 |
tagc |
10678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0005 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0005
Description:
Target: scaffold0005; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 102 - 204
Target Start/End: Complemental strand, 44814 - 44711
Alignment:
| Q |
102 |
tgagcttatctcatttggtaagga-taatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctc |
200 |
Q |
| |
|
|||||||| |||||||||||||| ||||||||||| | | ||||| || |||||||||| | |||||| ||||||| | ||||||||||||| |||| |
|
|
| T |
44814 |
tgagcttagttcatttggtaaggaataatgcataatttaagtgggggttggagttcgaaccctgaacaccctacttatttacctttaaggtgaatatctc |
44715 |
T |
 |
| Q |
201 |
tagc |
204 |
Q |
| |
|
|||| |
|
|
| T |
44714 |
tagc |
44711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0003 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: scaffold0003
Description:
Target: scaffold0003; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 93 - 176
Target Start/End: Original strand, 315644 - 315727
Alignment:
| Q |
93 |
caatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| || ||| |||| |||| |||||||||||| ||||| ||| ||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
315644 |
caatccccgtgaacttagctcagttggtaaggatattgcattttatatgcaggggtcgatgttcgaaccccggacatcccactt |
315727 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0707 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0707
Description:
Target: scaffold0707; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Complemental strand, 86 - 12
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||| |||||| |||||| |
|
|
| T |
86 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccctggacactccactt |
12 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0339 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0339
Description:
Target: scaffold0339; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 172 - 210
Target Start/End: Complemental strand, 12686 - 12648
Alignment:
| Q |
172 |
cacttattcatctttaaggtgaatttctctagccactag |
210 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||| |
|
|
| T |
12686 |
cacttattcatctttaaggtgaatttttctagccactag |
12648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 123 - 181
Target Start/End: Original strand, 24405 - 24463
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
||||| |||||||| | |||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
24405 |
ggatattgcataatttatgcaggggccggggttcgaaccccggacactccacttcttca |
24463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0128 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0128
Description:
Target: scaffold0128; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 17624 - 17698
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | |||||||||||||||||||| |||||| |
|
|
| T |
17624 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagctggggttcgaaccccggacactccactt |
17698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 122 - 220
Target Start/End: Original strand, 101851 - 101948
Alignment:
| Q |
122 |
aggataatgcataat-atgtgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggctacttga |
219 |
Q |
| |
|
|||||||||||| || || |||||||| ||||||||||||||| ||| |||||||||||| ||| |||||||||| |||||||||||| |||| ||| |
|
|
| T |
101851 |
aggataatgcattattatatgcaggggccggggttcgaaccccaaacatcccacttattcaccttataaggtgaat---tctagccactagactacgtga |
101947 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 140 - 182
Target Start/End: Original strand, 25065 - 25107
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcat |
182 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25065 |
tgcaggggctggggttcgaaccccggacaccccacttattcat |
25107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0015 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0015
Description:
Target: scaffold0015; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 157 - 218
Target Start/End: Complemental strand, 63902 - 63840
Alignment:
| Q |
157 |
gaaccccggacaccccacttattcat-ctttaaggtgaatttctctagccactaggctacttg |
218 |
Q |
| |
|
||||||| ||| ||||||||||||| |||||||||||||||||||| ||||||| ||||||| |
|
|
| T |
63902 |
gaaccccaaacatcccacttattcattctttaaggtgaatttctctaaccactagactacttg |
63840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 35; Significance: 0.00000000009; HSPs: 1)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 35; E-Value: 0.00000000009
Query Start/End: Original strand, 143 - 185
Target Start/End: Complemental strand, 451428 - 451386
Alignment:
| Q |
143 |
aggggtcggggttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||| |||||||||||| |||||||||||||||||||||||| |
|
|
| T |
451428 |
aggggccggggttcgaactccggacaccccacttattcatctt |
451386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0533 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0533
Description:
Target: scaffold0533; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 214
Target Start/End: Original strand, 9365 - 9437
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatttctctagccactaggcta |
214 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||||||||||| ||| |||||||||| |||||||||||||||| |
|
|
| T |
9365 |
tgcaggggtcggggttcgaattccgaacactccacttattcaccttataaggtgaat---tctagccactaggcta |
9437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 6689 - 6648
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
6689 |
tgcaggggccggggttcgaaccccggacaccccaattattca |
6648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0187
Description:
Target: scaffold0187; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 11177 - 11112
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
11177 |
ctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
11112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0187; HSP #2
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 111 - 176
Target Start/End: Complemental strand, 21505 - 21440
Alignment:
| Q |
111 |
ctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||||| |||||| |
|
|
| T |
21505 |
ctcagttggtagggatattgcatattatatgcaggagccggggttcgaaccccggacactccactt |
21440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121 (Bit Score: 34; Significance: 0.0000000004; HSPs: 2)
Name: scaffold0121
Description:
Target: scaffold0121; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 102 - 175
Target Start/End: Original strand, 46530 - 46603
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||||| |||||||||||||| ||||| ||||| |
|
|
| T |
46530 |
tgagcttagctcagttggtagggatattgcatattatatgcaggggctggggttcgaaccccagacactccact |
46603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0121; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 12002 - 12072
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| |||||| ||||| |||||| ||| |||||| | ||||||| ||||||||||||| |||||| |
|
|
| T |
12002 |
cttagctcagttggtagggatattgcatattatatgcaggagccggggtttgaaccccggacactccactt |
12072 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 123 - 176
Target Start/End: Complemental strand, 18524 - 18471
Alignment:
| Q |
123 |
ggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
||||| |||||| ||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
18524 |
ggatattgcatattatatacaggggccggggttcgaaccccggacaccccactt |
18471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 185
Target Start/End: Original strand, 5355 - 5387
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt |
185 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
5355 |
gttcgaaccccggacaccccacttattcatctt |
5387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0238 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0238
Description:
Target: scaffold0238; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 25390 - 25458
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||||| |||| |||||||||| |||||||||||| |||| || | ||||||||||||| |||||| |
|
|
| T |
25390 |
tgagcttaactcagttggtaaggacaatgcataatatatgcaaggtccagggttcgaaccccagacacc |
25458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 140 - 176
Target Start/End: Complemental strand, 28849 - 28813
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||||||||||||||||||||||||||| |
|
|
| T |
28849 |
tgcaggggccggggttcgaaccccggacaccccactt |
28813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0020 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: scaffold0020
Description:
Target: scaffold0020; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 153 - 196
Target Start/End: Original strand, 166648 - 166692
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||| ||||||||||||||| ||||||||||| |
|
|
| T |
166648 |
gttcgaaccccggacactccacttattcatcttataaggtgaatt |
166692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0087 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0087
Description:
Target: scaffold0087; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 153 - 220
Target Start/End: Complemental strand, 44398 - 44331
Alignment:
| Q |
153 |
gttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgac |
220 |
Q |
| |
|
|||||||||||| ||||| |||||||| | |||||||||||||| ||||||| | || ||||||||| |
|
|
| T |
44398 |
gttcgaaccccgaacacctcacttatttacatttaaggtgaatttttctagccgccagactacttgac |
44331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0063 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0063
Description:
Target: scaffold0063; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 102 - 169
Target Start/End: Original strand, 56327 - 56394
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacac |
169 |
Q |
| |
|
|||||||| |||| |||| | ||||| |||||| ||| |||||||| ||||||||||||||| ||||| |
|
|
| T |
56327 |
tgagcttaactcaattggcagggatattgcatattatatgcaggggccggggttcgaaccccagacac |
56394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 129 - 176
Target Start/End: Complemental strand, 66627 - 66580
Alignment:
| Q |
129 |
tgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||| ||| |||||||| |||||||||||||||||||||| ||||| |
|
|
| T |
66627 |
tgcatattatatgcaggggccggggttcgaaccccggacacctcactt |
66580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0034 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0034
Description:
Target: scaffold0034; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 104 - 175
Target Start/End: Original strand, 94657 - 94728
Alignment:
| Q |
104 |
agcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccact |
175 |
Q |
| |
|
|||||| |||| |||||| ||||| ||||| || |||||||||| |||||||||||||||||||| |||| |
|
|
| T |
94657 |
agcttagctcagttggtatggatattgcatgtcatatgcaggggtcagggttcgaaccccggacacctcact |
94728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0013 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0013
Description:
Target: scaffold0013; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 140 - 179
Target Start/End: Complemental strand, 245512 - 245473
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttatt |
179 |
Q |
| |
|
|||||||||||||||||||| |||| |||||||||||||| |
|
|
| T |
245512 |
tgcaggggtcggggttcgaaacccgaacaccccacttatt |
245473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1787 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1787
Description:
Target: scaffold1787; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 106 - 176
Target Start/End: Original strand, 408 - 478
Alignment:
| Q |
106 |
cttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||| |||| ||| || ||||| |||||| ||| |||||||| ||||||||||||| ||||||| |||||| |
|
|
| T |
408 |
cttagctcaattgatagggatattgcatattatatgcaggggccggggttcgaacctcggacactccactt |
478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1709 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1709
Description:
Target: scaffold1709; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 163
Target Start/End: Original strand, 174 - 236
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
||||||||| |||| |||||| |||| |||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
174 |
atgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacccc |
236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1331 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold1331
Description:
Target: scaffold1331; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 101 - 163
Target Start/End: Complemental strand, 147 - 85
Alignment:
| Q |
101 |
atgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaacccc |
163 |
Q |
| |
|
||||||||| |||| |||||| |||| |||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
147 |
atgagcttagctcagttggtatagatattgcatattatatgcaggggccggggttcgaacccc |
85 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 3670 - 3744
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||||||||||| |||||| |
|
|
| T |
3670 |
tgagcttaactcagttggtagggatattgcatattatatgcaggaaccagggttcgaaccccggacactccactt |
3744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0608 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0608
Description:
Target: scaffold0608; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 8970 - 9044
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||| |||||||||||||| || |||||| |
|
|
| T |
8970 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggagttcgaaccccggatactccactt |
9044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0250 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0250
Description:
Target: scaffold0250; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 102 - 176
Target Start/End: Original strand, 15009 - 15083
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccactt |
176 |
Q |
| |
|
|||||||| |||| |||||| ||| | |||||||| | |||||||||| |||||||||||| ||||||||||| |
|
|
| T |
15009 |
tgagcttagctcagttggtagggacattgcataatttatgcaggggtcatggttcgaaccccaaacaccccactt |
15083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0227 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: scaffold0227
Description:
Target: scaffold0227; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 140 - 221
Target Start/End: Original strand, 21889 - 21966
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctttaaggtgaatttctctagccactaggctacttgacc |
221 |
Q |
| |
|
||||||||| |||||||||| |||| |||||||||||||||| |||||| |||||| |||||||||||| |||| ||||| |
|
|
| T |
21889 |
tgcaggggttggggttcgaa-cccgaacaccccacttattca-ctttaaaatgaatt--tctagccactagactacctgacc |
21966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1990 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold1990
Description:
Target: scaffold1990; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 933 - 990
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
933 |
tgcaggggctggggttcgaatcccagacaccccacttattcaccttataaggtgaatt |
990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0294 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0294
Description:
Target: scaffold0294; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 181
Target Start/End: Complemental strand, 17289 - 17248
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
181 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| |||| |
|
|
| T |
17289 |
tgcaggggccggggttcgaaccccggacactccacttcttca |
17248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0275 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0275
Description:
Target: scaffold0275; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 87 - 164
Target Start/End: Original strand, 8810 - 8886
Alignment:
| Q |
87 |
ataaatcaatcaccatgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccg |
164 |
Q |
| |
|
|||||| |||| || |||||||| |||| |||||| ||||| ||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
8810 |
ataaattaatccccgtgagcttagctcagttggtagggatattgcattttatatgcaggg-tcggggttcgaaccccg |
8886 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 140 - 196
Target Start/End: Complemental strand, 47373 - 47316
Alignment:
| Q |
140 |
tgcaggggtcggggttcgaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
|||||||| |||||||||| ||| ||||||||||||||||| ||| ||||||||||| |
|
|
| T |
47373 |
tgcaggggctggggttcgaatcccagacaccccacttattcaccttataaggtgaatt |
47316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1086 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1086
Description:
Target: scaffold1086; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 157 - 196
Target Start/End: Original strand, 2544 - 2584
Alignment:
| Q |
157 |
gaaccccggacaccccacttattcatctt-taaggtgaatt |
196 |
Q |
| |
|
||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
2544 |
gaaccccggacaccccacttattcaccttataaggtgaatt |
2584 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0026 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0026
Description:
Target: scaffold0026; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 170
Target Start/End: Original strand, 75326 - 75394
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacacc |
170 |
Q |
| |
|
|||||| | |||| |||||||||| |||||||||||| |||| || ||||||||||| ||||| |||| |
|
|
| T |
75326 |
tgagctaagctcagttggtaaggacaatgcataatatatgcaaggtccggggttcgaatcccggccacc |
75394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 102 - 174
Target Start/End: Complemental strand, 266763 - 266691
Alignment:
| Q |
102 |
tgagcttatctcatttggtaaggataatgcataatatgtgcaggggtcggggttcgaaccccggacaccccac |
174 |
Q |
| |
|
|||||||| |||| |||||| ||||| |||||| ||| |||||| | ||||||||||| ||| ||||| |||| |
|
|
| T |
266763 |
tgagcttagctcagttggtagggatattgcatattatatgcaggagccggggttcgaaacccagacactccac |
266691 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University