View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_high_90 (Length: 247)
Name: NF11737A_high_90
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_high_90 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 211; Significance: 1e-116; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 211; E-Value: 1e-116
Query Start/End: Original strand, 18 - 228
Target Start/End: Original strand, 49563286 - 49563496
Alignment:
| Q |
18 |
atcaagagttagagcaacttataaatggtcaaatatgcttcaagatttatccatttagaagtggtatagttaaacctttgtgcagaagcaatattattac |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563286 |
atcaagagttagagcaacttataaatggtcaaatatgcttcaagatttatccatttagaagtggtatagttaaacctttgtgcagaagcaatattattac |
49563385 |
T |
|
| Q |
118 |
agttacaatgacgatttactttgttattgataattttttattctctggtttcagagataccagcagaaaggaaaataatactgcctggttctttcaatcc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
49563386 |
agttacaatgacgatttactttgttattgataattttttattctctggtttcagagataccagcagaaaggaaaataatactgcctggttctttcaatcc |
49563485 |
T |
|
| Q |
218 |
tttacatgatg |
228 |
Q |
| |
|
||||||||||| |
|
|
| T |
49563486 |
tttacatgatg |
49563496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University