View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_high_93 (Length: 239)
Name: NF11737A_high_93
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_high_93 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 185; Significance: 1e-100; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 15 - 211
Target Start/End: Original strand, 10566857 - 10567053
Alignment:
| Q |
15 |
tggacatcactacaaatttactttggtccttttgccaagaggatgttactgagggtccagaacaactatataactcagagatagcactatattgactttc |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10566857 |
tggacatcactacaaatttactttggtccttttgccaagaggatgttactgagggtccagaacaactatataactcagagatagcactatattgactttc |
10566956 |
T |
 |
| Q |
115 |
aaactcaccacggtctggaatagatctaatcgtcttcatgaactctaaataatcagtccccatacatggaacctccgagttgatgtccatctcattg |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | ||| |||||||| |
|
|
| T |
10566957 |
aaactcaccacggtctggaatagatctaatcgtcttcatgaactctaaataatcagtccccatacatggaacctccgagttgttttccttctcattg |
10567053 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University