View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_105 (Length: 375)
Name: NF11737A_low_105
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_105 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 317; Significance: 1e-179; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 317; E-Value: 1e-179
Query Start/End: Original strand, 20 - 356
Target Start/End: Original strand, 7752747 - 7753083
Alignment:
| Q |
20 |
ttgtccacctcgactttagcttggacagtctcaccggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctccgggaacag |
119 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
7752747 |
ttgttcacctcgactttagcttggacagtctcacaggcccaatccctgatttcttaggtcaactcaagaacctcgatgtcatcgacctctctgggaacag |
7752846 |
T |
|
| Q |
120 |
gtttaccggccaaatccctgcatcactaggtcgactcactaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctcctta |
219 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752847 |
gtttaccggccaaatccctgcatcactaggtcgactcaccaagcttagaagcgctaaccttggctcaaaccaactctccggcccaatcccagcctcctta |
7752946 |
T |
|
| Q |
220 |
ggcatgatcaagagcctagaacaactctacatatacattaacaacttatctggcccaattccagcttctttagctcaacttcctaaactcaacgaacttt |
319 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7752947 |
ggcatgatcaagagcctagaacaactctacatatacattaacaacttatctggcccaattccagcttctttagctcaacttcctaaactcaacgaacttt |
7753046 |
T |
|
| Q |
320 |
ccctatttcaaaaccagctaaccggctcaatccctga |
356 |
Q |
| |
|
||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
7753047 |
ccctatttcaaaaccagttaaccggctcaatccctga |
7753083 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University