View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_111 (Length: 367)
Name: NF11737A_low_111
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_111 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 18 - 348
Target Start/End: Complemental strand, 2730795 - 2730465
Alignment:
| Q |
18 |
atcagaaaatggtctcgagagagagtggcaaggaggagaagagtatggcttcaagtgtttggaatcccccttcatgcatgagaggaagggttcttcaagc |
117 |
Q |
| |
|
|||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
2730795 |
atcataaaatggtctcgagagaaagtggcaaggaggagaagagtatggcttcaagtgtttggaatcccccttcatgcatgagaggaagggttcttcaacc |
2730696 |
T |
|
| Q |
118 |
ttcttgattcaaagttcagtgaattcatagattttacggtgatacaattcaaaggaaccatctagatgtggcatagatcctagtgtttttctcttaaaac |
217 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2730695 |
ttcttgattcaaagttcagagaattcatagattttacagtgatacaattcaaaggaaccatctagatgtggcatagatcctagtgtttttctcttaaaat |
2730596 |
T |
|
| Q |
218 |
ggggttgataggtggatctttcaccatttcaattgtaggtaaaaggtacaagatatgggtgaaggaagaagatttacggtggatgaatgggcggaggaac |
317 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2730595 |
ggggttaataggtggatctttcaccatttcaattgtaggtataaggtacaagatatgggtgaaggaagaagatttacggtggatgaatgggcggaggaac |
2730496 |
T |
|
| Q |
318 |
aacggtgaaggtagttcgattgagggtgatg |
348 |
Q |
| |
|
||| ||||||||||||||||||||||||||| |
|
|
| T |
2730495 |
aacagtgaaggtagttcgattgagggtgatg |
2730465 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University