View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_114 (Length: 366)
Name: NF11737A_low_114
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_114 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 315; Significance: 1e-177; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 315; E-Value: 1e-177
Query Start/End: Original strand, 17 - 361
Target Start/End: Original strand, 5678289 - 5678635
Alignment:
| Q |
17 |
gacatcacttggaatctcctgagaaaaaatcctataattaagcaatacaactcattggtttcagttactaaaatccaacaaaagttagcaaacaagaaca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678289 |
gacatcacttggaatctcctgagaaaaaatcctataattaagcaatacaactcattggtttcagttactaaaatccaacaaaagttagcaaacaagaaca |
5678388 |
T |
 |
| Q |
117 |
tgcacaagaaaagtgtcaagtacatttgacatatatatacataaacatnnnnnnn--tataccagtcacttgttcttttcatggcactagatagaagctc |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678389 |
tgcacaagaaaagtgtcaagtacatttgacatatatatacataaacataaaaaaaaatataccagtcacttgttcttttcatggcactagatagaagctc |
5678488 |
T |
 |
| Q |
215 |
ttgcttcttcacagacaagtcactagcagatgttgtagttttgtctagaccacgatccaccatggcaagtacagaaagatttctacctcactataaatga |
314 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678489 |
ttgcttcttcacagacaagtcactagcagatgttgtagttttgtctagaccacgatccaccatggcaagtacagaaagatttctacctcactataaatga |
5678588 |
T |
 |
| Q |
315 |
agcagaaaaagattaatgagtcagttatagtataggctcaaggacct |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5678589 |
agcagaaaaagattaatgagtcagttatagtataggctcaaggacct |
5678635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University