View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF11737A_low_122 (Length: 363)
Name: NF11737A_low_122
Description: NF11737A
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF11737A_low_122 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 289; Significance: 1e-162; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 289; E-Value: 1e-162
Query Start/End: Original strand, 60 - 348
Target Start/End: Original strand, 23118241 - 23118529
Alignment:
| Q |
60 |
gctgcagcaagcagattttctttttctcttctccctctttgtcatcgcaaaaaggagagggagcctacatagagggtgcagttggagaggaagcatcaga |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118241 |
gctgcagcaagcagattttctttttctcttctccctctttgtcatcgcaaaaaggagagggagcctacatagagggtgcagttggagaggaagcatcaga |
23118340 |
T |
 |
| Q |
160 |
agaagatgagacatcaggcggattcatgttaaaaaccgaaggctggagaggatttgcggccagaggaggcatgttgagaaggatgttaagcgcgcttgct |
259 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118341 |
agaagatgagacatcaggcggattcatgttaaaaaccgaaggctggagaggatttgcggccagaggaggcatgttgagaaggatgttaagcgcgcttgct |
23118440 |
T |
 |
| Q |
260 |
tgccagttcctctgaatttgtaattcaagagtattgtaggccagatggttcatgatggcaatttgattttcacacagcttacggatgtc |
348 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23118441 |
tgccagttcctctgaatttgtaattcaagagtattgtaggccagatggttcatgatggcaatttgattttcacacagcttacggatgtc |
23118529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University